MedBlast Result

MedBlast(0.8) Results

Direct References
Indirect References
Options
BLASTN
BLASTX

Direct References:

Hit	Evalue	SeqType	References
L36897	0.0	N	Gene 1986;47(2-3):155-77
AJ011856	0.0	N	FEBS Lett 1998 Dec 4;440(3):325-31
V00694	0.0	N	J Biol Chem 1980 Dec 25;255(24):11927-41
X14910	5e-92	N	Nucleic Acids Res 1989 Jun 26;17(12):4886
Z11698	5e-86	N	Nucleic Acids Res 1992 Apr 11;20(7):1747-54
U00801	1e-83	N	Gene 1994 Feb 11;139(1):1-7
M97514	2e-76	N	J Mol Evol 1997 Mar;44(3):341-7 Gene 1993 Feb 28;124(2):153-63
J01508	4e-43	N	Gene 1983 Mar;21(3):193-202
AF437291	3e-38	N	J Mol Biol 2002 May 3;318(3):627-36
X57546	2e-26	N	Cytokine 1991 Jul;3(4):269-76 Curr Genet 1991 Jul;20(1-2):99-114 FEBS Lett 1997 Aug 18;413(2):333-8
NP_009310	0.0	P
S78642	0.0	P	Int Immunol 1995 Mar;7(3):425-34
CAA09825	0.0	P
P03875	0.0	P
QXBY31	0.0	P
AAA67532	0.0	P
CAA24071	0.0	P
NP_009309	0.0	P
S78644	0.0	P	Int Immunol 1995 Mar;7(3):425-34
CAA09826	0.0	P
S17995	0.0	P
P03876	1e-162	P
QXBY32	1e-162	P
CAA24060	1e-162	P
CAA40766	1e-161	P
1803222B	1e-161	P
NP_150408	3e-95	P
CAC50849	3e-95	P
E48327	1e-86	P	J Mol Biol 1997 Jul 11;270(2):179-87
CAA38781	1e-86	P
AAA32006	2e-80	P
S07649	4e-80	P
NP_074925	4e-80	P
B48327	4e-80	P
CAA38778	4e-80	P
NP_150406	8e-79	P
CAC50847	8e-79	P
NP_039503	2e-78	P
P05511	2e-78	P
CAA26587	2e-78	P
CAA38288	2e-78	P
NP_043734	3e-77	P
S63652	3e-77	P
AAC49235	3e-77	P
AAB95256	4e-75	P
AAF27656	5e-75	P
CAB61571	2e-74	P
NP_066494	6e-74	P
AAG17765	6e-74	P
S78199	3e-72	P	Biochem J 1995 May 1;307 ( Pt 3):729-34
NP_700366	2e-67	P
AAN31941	2e-67	P
NP_150407	2e-65	P
CAC50848	2e-65	P
ZP_00099281	4e-63	P
Q57005	2e-62	P
S77648	2e-62	P
CAA61996	2e-62	P
AAB06503	2e-62	P
AAF98310	5e-62	P
NP_054460	3e-61	P
P38478	3e-61	P
S26004	3e-61	P
AAC09457	3e-61	P
NP_054457	1e-57	P
S25957	1e-57	P
AAC09454	1e-57	P
NP_049088	3e-57	P
T31160	3e-57	P
AAD03884	3e-57	P
AAD12069	6e-55	P
NP_049098	2e-51	P
T31170	2e-51	P
AAD03894	2e-51	P
NP_054463	3e-48	P
S26006	3e-48	P
AAC09460	3e-48	P
NP_066492	4e-48	P
AAG17763	4e-48	P
S72681	4e-46	P
CAB76395	3e-42	P
NP_074948	3e-42	P
S09145	3e-42	P
NP_054449	1e-39	P
S25997	1e-39	P
AAC09444	1e-39	P
NP_054444	9e-38	P
S25952	9e-38	P
AAC09440	9e-38	P
NP_700371	2e-36	P
AAN31946	2e-36	P
NP_054435	9e-35	P
S25949	9e-35	P
AAC09431	9e-35	P
NP_054448	2e-30	P
S25954	2e-30	P
AAC09445	2e-30	P
NP_054445	1e-27	P
P38456	1e-27	P
S25995	1e-27	P
AAC09442	1e-27	P
NP_054458	2e-27	P
S26002	2e-27	P
AAC09455	2e-27	P
NP_053121	2e-26	P
BAA84894	2e-26	P
NP_708749	2e-26	P
AAN44456	2e-26	P
NP_687596	1e-25	P
AAM99468	1e-25	P
NP_414792	2e-25	P
Q47688	2e-25	P
B64751	2e-25	P
AAB08678	2e-25	P
AAC73361	2e-25	P
AAB86996	3e-25	P

References Summary:

de Zamaroczy M, Bernardi G
The primary structure of the mitochondrial genome of Saccharomyces cerevisiae--a review.
Gene 1986;47(2-3):155-77
PMID: 3549452
Foury F, Roganti T, Lecrenier N, Purnelle B
The complete sequence of the mitochondrial genome of Saccharomyces cerevisiae.
FEBS Lett 1998 Dec 4;440(3):325-31
PMID: 9872396
Bonitz SG, Coruzzi G, Thalenfeld BE, Tzagoloff A, Macino G
Assembly of the mitochondrial membrane system. Structure and nucleotide sequence of the gene coding for subunit 1 of yeast cytochrme oxidase.
J Biol Chem 1980 Dec 25;255(24):11927-41
PMID: 6254986
Seraphin B, Simon M, Jacq C, Faye G
Sequence of the yeast mitochondrial OX13/OL12 promoter region.
Nucleic Acids Res 1989 Jun 26;17(12):4886
PMID: 2664712
Hebbar SK, Belcher SM, Perlman PS
A maturase-encoding group IIA intron of yeast mitochondria self-splices in vitro.
Nucleic Acids Res 1992 Apr 11;20(7):1747-54
PMID: 1579468
Szczepanek T, Macadre C, Meunier B, Lazowska J
Two homologous introns from related Saccharomyces species differ in their mobility.
Gene 1994 Feb 11;139(1):1-7
PMID: 8112577
Yasuhira S, Simpson L
Phylogenetic affinity of mitochondria of Euglena gracilis and kinetoplastids using cytochrome oxidase I and hsp60.
J Mol Evol 1997 Mar;44(3):341-7
PMID: 9060401
Tian GL, Michel F, Macadre C, Lazowska J
Sequence of the mitochondrial gene encoding subunit I of cytochrome oxidase in Saccharomyces douglasii.
Gene 1993 Feb 28;124(2):153-63
PMID: 8383070
de Zamaroczy M, Faugeron-Fonty G, Bernardi G
Excision sequences in the mitochondrial genome of yeast.
Gene 1983 Mar;21(3):193-202
PMID: 6343188
Petersen RF, Langkjaer RB, Hvidtfeldt J, Gartner J, Palmen W, Ussery DW, Piskur J
Inheritance and organisation of the mitochondrial genome differ between two Saccharomyces yeasts.
J Mol Biol 2002 May 3;318(3):627-36
PMID: 12054811
Richards CD, Saklatvala J
Molecular cloning and sequence of porcine interleukin 6 cDNA and expression of mRNA in synovial fibroblasts in vitro.
Cytokine 1991 Jul;3(4):269-76
PMID: 1873476
Hardy CM, Clark-Walker GD
Nucleotide sequence of the COX1 gene in Kluyveromyces lactis mitochondrial DNA: evidence for recent horizontal transfer of a group II intron.
Curr Genet 1991 Jul;20(1-2):99-114
PMID: 1657415
Norman JE, Gray MW
The cytochrome oxidase subunit 1 gene (cox1) from the dinoflagellate, Crypthecodinium cohnii.
FEBS Lett 1997 Aug 18;413(2):333-8
PMID: 9280308
Xie C, Bruhl H, He X, Weyand CM, Goronzy JJ
Selective activation of VH3A10+ rheumatoid factor producing B cells by staphylococcal enterotoxin D.
Int Immunol 1995 Mar;7(3):425-34
PMID: 7794822
Vogel J, Hubschmann T, Borner T, Hess WR
Splicing and intron-internal RNA editing of trnK-matK transcripts in barley plastids: support for MatK as an essential splice factor.
J Mol Biol 1997 Jul 11;270(2):179-87
PMID: 9236120
Aguilar JS, Tan F, Durand I, Green RD
Isolation and characterization of an avian A1 adenosine receptor gene and a related cDNA clone.
Biochem J 1995 May 1;307 ( Pt 3):729-34
PMID: 7741703

Indirect References:

Hit	Evalue	SeqType	References
L36897	0.0	N	oxi3p (-) cox1p FEBS Lett 1999 Mar 19;447(1):65-70 J Biol Chem 2000 May 19;275(20):14898-902 Mol Biol Cell 2003 Jan;14(1):324-33 Curr Genet 1998 Aug;34(2):138-45 Curr Genet 2000 Apr;37(4):213-20 Genetics 2001 Jun;158(2):573-85 cox1 Nucleic Acids Res 1992 Jun 11;20(11):2647-55 Mol Gen Genet 1993 Sep;240(3):419-27 Curr Genet 1998 Aug;34(2):138-45 Nature 1993 Nov 11;366(6451):174-6 Curr Genet 1995 Aug;28(3):217-24 Eur J Biochem 1994 May 15;222(1):27-32 EMBO J 2002 Jan 15;21(1-2):43-52 Eur J Biochem 1993 Apr 1;213(1):137-45 J Mol Biol 1994 Oct 21;243(2):157-66 Genetics 1997 Mar;145(3):697-705 Mol Cell Biol 1992 Feb;12(2):716-23 Genetics 2001 Jun;158(2):573-85 Nature 1996 May 23;381(6580):332-5 Nucleic Acids Res 1994 Dec 25;22(25):5745-52 Mol Gen Genet 1997 Sep;256(1):88-91 Nucleic Acids Res 1992 Dec 11;20(23):6339-46 J Mol Biol 1996 Apr 19;257(5):1019-30 J Mol Biol 1994 Jun 3;239(2):201-12 Curr Genet 1994 Nov-Dec;26(5-6):542-5 Eur J Biochem 1998 Jul 1;255(1):156-61 Curr Genet 1997 Feb;31(2):119-21 Curr Genet 1997 Jan;31(1):80-8 Curr Genet 1999 Jul;35(6):602-8 Mol Biol Cell 2003 Jan;14(1):324-33 J Biol Chem 2001 Jul 6;276(27):25262-72 Cell 1993 Apr 9;73(1):133-46 EMBO J 1995 Aug 15;14(16):4031-43 Curr Genet 1992 Dec;22(6):505-6 Curr Genet 1992 Feb;21(2):139-46 Eur J Biochem 1993 Apr 1;213(1):129-35 J Mol Biol 1993 Jul 5;232(1):79-88 FEBS Lett 2000 Dec 22;487(1):82-6 J Mol Biol 1997 Apr 4;267(3):537-47 Int J Food Microbiol 2003 Feb 25;81(1):63-71 FEBS Lett 1996 Feb 26;381(1-2):42-6 Nucleic Acids Res 1992 Aug 11;20(15):3897-904 Curr Genet 2000 Apr;37(4):213-20 J Biol Chem 1998 Oct 23;273(43):27945-52 J Biol Chem 2001 Mar 16;276(11):8616-22 Curr Genet 2002 Nov;42(2):94-102 [Total: 59. Click here for MORE] oxi3 Acta Microbiol Pol 1982;31(3-4):239-48 Curr Genet 1986;11(3):185-91 Gene 1984 Dec;32(3):459-73 J Biol Chem 1982 Mar 25;257(6):3218-24 EMBO J 1988 Feb;7(2):473-83 Proc Natl Acad Sci U S A 1981 Mar;78(3):1778-82 Cell 1981 Nov;27(1 Pt 2):4-11 Cell 1983 Dec;35(3 Pt 2):733-42 Mol Gen Genet 1984;196(2):266-74 Cell 1982 Apr;28(4):733-8 Nucleic Acids Res 1983 Jul 11;11(13):4435-51 EMBO J 1983;2(2):269-76 Cell 1985 May;41(1):133-43 J Biol Chem 1983 Feb 10;258(3):1991-9 Science 1988 Jun 10;240(4858):1538-41 J Bacteriol 1979 Aug;139(2):460-70 Mol Gen Genet 1982;188(1):51-9 Cell 1982 Jun;29(2):505-15 Mol Gen Genet 1979 Jan 2;167(3):301-8 Eur J Biochem 1985 Feb 15;147(1):191-6 EMBO J 1983;2(11):2047-52 Eur J Biochem 1982 Oct;127(2):411-6 Mol Gen Genet 1991 Apr;226(1-2):233-40 Eur J Biochem 1984 Oct 1;144(1):85-93 Curr Genet 1989 Apr;15(4):291-3; discussion 293-4 J Biol Chem 1979 Apr 10;254(7):2480-90 Mol Gen Genet 1981;184(3):493-503 Mol Gen Genet 1979 Nov;176(3):411-5 J Mol Biol 1984 Jun 5;175(4):431-52 Curr Genet 1992 Feb;21(2):147-51 Gene 1992 Dec 1;122(1):91-9 Curr Genet 1986;11(1):55-63 Curr Genet 1985;10(2):87-93 Nucleic Acids Res 1985 Apr 25;13(8):3005-14 J Biol Chem 1980 Dec 25;255(24):11922-6 J Biol Chem 1980 Dec 25;255(24):11927-41 Plasmid 1984 Jul;12(1):41-51
AJ011856	0.0	N	scai1 (-)
V00694	0.0	N
X14910	5e-92	N
Z11698	5e-86	N
U00801	1e-83	N
M97514	2e-76	N	coxi J Mol Biol 1991 Apr 20;218(4):735-46 Gene 1993 Feb 28;124(2):153-63
J01508	4e-43	N
AF437291	3e-38	N	cox1 (...)
X57546	2e-26	N	cox1 (...)
NP_009310	0.0	P	ai1p (-) ai1 Proc Natl Acad Sci U S A 2001 Nov 6;98(23):13207-12 Mol Gen Genet 1993 Sep;240(3):419-27 J Mol Biol 1998 Sep 25;282(3):505-23 Nature 1993 Nov 11;366(6451):174-6 Mol Gen Genet 1989 May;217(1):168-71 Mol Cell Biol 1995 May;15(5):2828-38 J Mol Biol 1994 Oct 21;243(2):157-66 Curr Genet 1988 Mar;13(3):219-26 Mol Gen Genet 1990 Sep;223(2):249-57 EMBO J 1994 Oct 17;13(20):4963-72 Gene Expr 1992;2(3):203-14 Curr Genet 1988 Feb;13(2):129-35 Nature 1996 May 23;381(6580):332-5 Nucleic Acids Res 1982 Nov 11;10(21):6797-808 Curr Genet 1986;11(1):55-63 Gene 1994 Feb 11;139(1):1-7 Curr Genet 1994 Nov-Dec;26(5-6):542-5
S78642	0.0	P
CAA09825	0.0	P	scai1 (-)
P03875	0.0	P
QXBY31	0.0	P
AAA67532	0.0	P	oxi3p (-) cox1p (...) cox1 (...) oxi3 (...)
CAA24071	0.0	P
NP_009309	0.0	P	ai2p (-) ai2 Cell 1995 Aug 25;82(4):545-54 Mol Gen Genet 1993 Sep;240(3):419-27 J Mol Biol 1998 Sep 25;282(3):505-23 EMBO J 1997 Nov 17;16(22):6835-48 Cell Mol Life Sci 1999 Nov 30;56(9-10):825-42 Curr Genet 1999 Jul;35(6):602-8 Mol Cell Biol 1995 May;15(5):2828-38 Mol Gen Genet 1989 May;217(1):168-71 Cell 1993 Apr 9;73(1):133-46 Curr Genet 1988 Mar;13(3):219-26 EMBO J 1994 Oct 17;13(20):4963-72 Mol Gen Genet 1990 Sep;223(2):249-57 Nature 1996 May 23;381(6580):332-5 Nucleic Acids Res 1994 Jun 11;22(11):2057-64 Nucleic Acids Res 1982 Nov 11;10(21):6797-808 Curr Genet 1986;11(1):55-63 Biochem Genet 1988 Aug;26(7-8):503-10 RNA 2000 Dec;6(12):1882-94
S78644	0.0	P
CAA09826	0.0	P	scai2 (-)
S17995	0.0	P
P03876	1e-162	P
QXBY32	1e-162	P
CAA24060	1e-162	P
CAA40766	1e-161	P	cox1 (...)
1803222B	1e-161	P
NP_150408	3e-95	P
CAC50849	3e-95	P
E48327	1e-86	P
CAA38781	1e-86	P	coi Curr Genet 1989 Dec;16(5-6):381-406 Proc Natl Acad Sci U S A 1997 Sep 30;94(20):10768-73 Curr Genet 2000 Apr;37(4):268-75 Curr Genet 1986;10(12):915-22 Curr Genet 1985;9(5):373-82 J Mol Biol 1993 Jun 5;231(3):559-68 EMBO J 1990 Jul;9(7):2289-98
AAA32006	2e-80	P
S07649	4e-80	P
NP_074925	4e-80	P
B48327	4e-80	P
CAA38778	4e-80	P	coi (...)
NP_150406	8e-79	P
CAC50847	8e-79	P
NP_039503	2e-78	P	cob J Mol Biol 1985 Aug 5;184(3):353-66 Curr Genet 1987;12(5):329-36 Gene 1986;45(3):289-97 J Mol Biol 1988 Aug 20;202(4):725-34 Mol Gen Genet 1984;196(3):465-72 Mol Gen Genet 1991 Jan;225(1):158-67
P05511	2e-78	P
CAA26587	2e-78	P
CAA38288	2e-78	P	cob (...)
NP_043734	3e-77	P
S63652	3e-77	P
AAC49235	3e-77	P
AAB95256	4e-75	P	cytb (-)
AAF27656	5e-75	P	maturase Curr Genet 1999 Mar;35(2):109-17
CAB61571	2e-74	P	cox1i1a (-)
NP_066494	6e-74	P
AAG17765	6e-74	P
S78199	3e-72	P
NP_700366	2e-67	P
AAN31941	2e-67	P
NP_150407	2e-65	P
CAC50848	2e-65	P
ZP_00099281	4e-63	P	desu2418 (-)
Q57005	2e-62	P
S77648	2e-62	P
CAA61996	2e-62	P	matr (-)
AAB06503	2e-62	P	ltra J Mol Biol 2002 Dec 13;324(5):933-51 Antonie Van Leeuwenhoek 1999 Jul-Nov;76(1-4):77-88 Nature 2000 Apr 27;404(6781):1018-21 J Mol Biol 2002 Apr 26;318(2):287-303 Mol Microbiol 2000 Aug;37(3):639-51 Genes Dev 1997 Nov 1;11(21):2910-24 Mol Microbiol 2002 Dec;46(5):1259-72 Biochemistry 1999 Jul 13;38(28):9069-83 J Bacteriol 1996 Jun;178(12):3531-8 Mol Cell 1999 Aug;4(2):239-50 Cell 1998 Aug 21;94(4):451-62
AAF98310	5e-62	P	matr (-)
NP_054460	3e-61	P	18s Plant Mol Biol 1999 Nov;41(5):679-85 J Mol Evol 1995 Jul;41(1):74-84
P38478	3e-61	P
S26004	3e-61	P
AAC09457	3e-61	P	18s (...)
NP_054457	1e-57	P	coxi (...)
S25957	1e-57	P
AAC09454	1e-57	P	coxi (...)
NP_049088	3e-57	P	matra (-)
T31160	3e-57	P
AAD03884	3e-57	P	matra (-)
AAD12069	6e-55	P
NP_049098	2e-51	P
T31170	2e-51	P
AAD03894	2e-51	P
NP_054463	3e-48	P	atp9 (-)
S26006	3e-48	P
AAC09460	3e-48	P	atp9 (-)
NP_066492	4e-48	P
AAG17763	4e-48	P
S72681	4e-46	P
CAB76395	3e-42	P	nd5 J Mol Biol 1990 Mar 20;212(2):269-86 J Mol Biol 1990 Mar 20;212(2):287-94
NP_074948	3e-42	P
S09145	3e-42	P
NP_054449	1e-39	P	atpa J Mol Biol 1988 Sep 20;203(2):299-331
S25997	1e-39	P
AAC09444	1e-39	P	atpa (...)
NP_054444	9e-38	P	cob (...)
S25952	9e-38	P
AAC09440	9e-38	P	cob (...)
NP_700371	2e-36	P
AAN31946	2e-36	P
NP_054435	9e-35	P	coxii (-)
S25949	9e-35	P
AAC09431	9e-35	P	coxii (-)
NP_054448	2e-30	P	atpa (...)
S25954	2e-30	P
AAC09445	2e-30	P	atpa (...)
NP_054445	1e-27	P	trna-gly (-)
P38456	1e-27	P
S25995	1e-27	P
AAC09442	1e-27	P	trna-gly (-)
NP_054458	2e-27	P	coxi (...)
S26002	2e-27	P
AAC09455	2e-27	P	coxi (...)
NP_053121	2e-26	P
BAA84894	2e-26	P
NP_708749	2e-26	P	sf2976 (-)
AAN44456	2e-26	P	sf2976 (-)
NP_687596	1e-25	P	sag0567 (-)
AAM99468	1e-25	P	sag0567 (-)
NP_414792	2e-25	P	ykfc (-) b0258 (-) eg13341 (-)
Q47688	2e-25	P
B64751	2e-25	P
AAB08678	2e-25	P
AAC73361	2e-25	P	ykfc (-) b0258 (-) eg13341 (-)
AAB86996	3e-25	P

References Summary:

Paret C, Ostermann K, Krause-Buchholz U, Rentzsch A, Rodel G
Human members of the SCO1 gene family: complementation analysis in yeast and intracellular localization.
FEBS Lett 1999 Mar 19;447(1):65-70
PMID: 10218584
Souza RL, Green-Willms NS, Fox TD, Tzagoloff A, Nobrega FG
Cloning and characterization of COX18, a Saccharomyces cerevisiae PET gene required for the assembly of cytochrome oxidase.
J Biol Chem 2000 May 19;275(20):14898-902
PMID: 10809734
Naithani S, Saracco SA, Butler CA, Fox TD
Interactions among COX1, COX2, and COX3 mRNA-specific Translational Activator Proteins on the Inner Surface of the Mitochondrial Inner Membrane of Saccharomyces cerevisiae.
Mol Biol Cell 2003 Jan;14(1):324-33
PMID: 12529447
Lemaire C, Robineau S, Netter P
Molecular and biochemical analysis of Saccharomyces cerevisiae cox1 mutants.
Curr Genet 1998 Aug;34(2):138-45
PMID: 9724417
Siep M, van Oosterum K, Neufeglise H, van der Spek H, Grivell LA
Mss51p, a putative translational activator of cytochrome c oxidase subunit-1 (COX1) mRNA, is required for synthesis of Cox1p in Saccharomyces cerevisiae.
Curr Genet 2000 Apr;37(4):213-20
PMID: 10803883
Stribinskis V, Gao GJ, Ellis SR, Martin NC
Rpm2, the protein subunit of mitochondrial RNase P in Saccharomyces cerevisiae, also has a role in the translation of mitochondrially encoded subunits of cytochrome c oxidase.
Genetics 2001 Jun;158(2):573-85
PMID: 11404323
Dekker PJ, Stuurman J, van Oosterum K, Grivell LA
Determinants for binding of a 40 kDa protein to the leaders of yeast mitochondrial mRNAs.
Nucleic Acids Res 1992 Jun 11;20(11):2647-55
PMID: 1377379
Groudinsky O, Bousquet I, Wallis MG, Slonimski PP, Dujardin G
The NAM1/MTF2 nuclear gene product is selectively required for the stability and/or processing of mitochondrial transcripts of the atp6 and of the mosaic, cox1 and cytb genes in Saccharomyces cerevisiae.
Mol Gen Genet 1993 Sep;240(3):419-27
PMID: 8413192
Mueller MW, Allmaier M, Eskes R, Schweyen RJ
Transposition of group II intron aI1 in yeast and invasion of mitochondrial genes at new locations.
Nature 1993 Nov 11;366(6451):174-6
PMID: 8232557
Golik P, Szczepanek T, Bartnik E, Stepien PP, Lazowska J
The S. cerevisiae nuclear gene SUV3 encoding a putative RNA helicase is necessary for the stability of mitochondrial transcripts containing multiple introns.
Curr Genet 1995 Aug;28(3):217-24
PMID: 8529267
Wallis MG, Groudinsky O, Slonimski PP, Dujardin G
The NAM1 protein (NAM1p), which is selectively required for cox1, cytb and atp6 transcript processing/stabilisation, is located in the yeast mitochondrial matrix.
Eur J Biochem 1994 May 15;222(1):27-32
PMID: 8200349
Barrientos A, Korr D, Tzagoloff A
Shy1p is necessary for full expression of mitochondrial COX1 in the yeast model of Leigh's syndrome.
EMBO J 2002 Jan 15;21(1-2):43-52
PMID: 11782424
Brown S, Colson AM, Meunier B, Rich PR
Rapid screening of cytochromes of respiratory mutants of Saccharomyces cerevisiae. Application to the selection of strains containing novel forms of cytochrome-c oxidase.
Eur J Biochem 1993 Apr 1;213(1):137-45
PMID: 8386620
Schmidt WM, Schweyen RJ, Wolf K, Mueller MW
Transposable group II introns in fission and budding yeast. Site-specific genomic instabilities and formation of group II IVS plDNAs.
J Mol Biol 1994 Oct 21;243(2):157-66
PMID: 7932746
Silar P, Koll F, Rossignol M
Cytosolic ribosomal mutations that abolish accumulation of circular intron in the mitochondria without preventing senescence of Podospora anserina.
Genetics 1997 Mar;145(3):697-705
PMID: 9055079
Wernette C, Saldanha R, Smith D, Ming D, Perlman PS, Butow RA
Complex recognition site for the group I intron-encoded endonuclease I-SceII.
Mol Cell Biol 1992 Feb;12(2):716-23
PMID: 1732740
Yang J, Zimmerly S, Perlman PS, Lambowitz AM
Efficient integration of an intron RNA into double-stranded DNA by reverse splicing.
Nature 1996 May 23;381(6580):332-5
PMID: 8692273
Thomson MC, Macfarlane JL, Beagley CT, Wolstenholme DR
RNA editing of mat-r transcripts in maize and soybean increases similarity of the encoded protein to fungal and bryophyte group II intron maturases: evidence that mat-r encodes a functional protein.
Nucleic Acids Res 1994 Dec 25;22(25):5745-52
PMID: 7838731
Johnson CH, McEwen JE
Mitochondrial protein synthesis is not required for efficient excision of intron aI5 beta from COX1 pre-mRNA in Saccharomyces cerevisiae.
Mol Gen Genet 1997 Sep;256(1):88-91
PMID: 9341683
Pel HJ, Maat C, Rep M, Grivell LA
The yeast nuclear gene MRF1 encodes a mitochondrial peptide chain release factor and cures several mitochondrial RNA splicing defects.
Nucleic Acids Res 1992 Dec 11;20(23):6339-46
PMID: 1475194
Lonergan KM, Gray MW
Expression of a continuous open reading frame encoding subunits 1 and 2 of cytochrome c oxidase in the mitochondrial DNA of Acanthamoeba castellanii.
J Mol Biol 1996 Apr 19;257(5):1019-30
PMID: 8632465
Bonnefoy N, Chalvet F, Hamel P, Slonimski PP, Dujardin G
OXA1, a Saccharomyces cerevisiae nuclear gene whose sequence is conserved from prokaryotes to eukaryotes controls cytochrome oxidase biogenesis.
J Mol Biol 1994 Jun 3;239(2):201-12
PMID: 8196054
Weiller GF
Frequent site-specific mit- deletions at cryptic exon-intron junctions in the COX1 gene of yeast mtDNA.
Curr Genet 1994 Nov-Dec;26(5-6):542-5
PMID: 7874750
Manthey GM, Przybyla-Zawislak BD, McEwen JE
The Saccharomyces cerevisiae Pet309 protein is embedded in the mitochondrial inner membrane.
Eur J Biochem 1998 Jul 1;255(1):156-61
PMID: 9692914
MacIver FH, Dawes IW, Grant CM
Identification of a Saccharomyces cerevisiae mitochondrial-DNA which can act as a promoter tightly regulated by carbon source when placed in the nucleus.
Curr Genet 1997 Feb;31(2):119-21
PMID: 9021127
Ogawa S, Matsuo K, Angata K, Yanagisawa K, Tanaka Y
Group-I introns in the cytochrome c oxidase genes of Dictyostelium discoideum: two related ORFs in one loop of a group-I intron, a cox1/2 hybrid gene and an unusually large cox3 gene.
Curr Genet 1997 Jan;31(1):80-8
PMID: 9000384
Schafer B, Wolf K
A novel group-II intron in the cox1 gene of the fission yeast Schizosaccharomyces pombe is inserted in the same codon as the mobile group-II intron aI2 in the Saccharomyces cerevisiae cox1 homologue.
Curr Genet 1999 Jul;35(6):602-8
PMID: 10467004
Ostrander DB, Zhang M, Mileykovskaya E, Rho M, Dowhan W
Lack of mitochondrial anionic phospholipids causes an inhibition of translation of protein components of the electron transport chain. A yeast genetic model system for the study of anionic phospholipid function in mitochondria.
J Biol Chem 2001 Jul 6;276(27):25262-72
PMID: 11335731
Kennell JC, Moran JV, Perlman PS, Butow RA, Lambowitz AM
Reverse transcriptase activity associated with maturase-encoding group II introns in yeast mitochondria.
Cell 1993 Apr 9;73(1):133-46
PMID: 7681727
Manthey GM, McEwen JE
The product of the nuclear gene PET309 is required for translation of mature mRNA and stability or production of intron-containing RNAs derived from the mitochondrial COX1 locus of Saccharomyces cerevisiae.
EMBO J 1995 Aug 15;14(16):4031-43
PMID: 7664742
Pich U, Kunze G
Genome organization of mitochondrial DNA from the non-saccharomycete yeast Arxula adeninivorans LS3.
Curr Genet 1992 Dec;22(6):505-6
PMID: 1473183
Pel HJ, Tzagoloff A, Grivell LA
The identification of 18 nuclear genes required for the expression of the yeast mitochondrial gene encoding cytochrome c oxidase subunit 1.
Curr Genet 1992 Feb;21(2):139-46
PMID: 1314704
Meunier B, Lemarre P, Colson AM
Genetic screening in Saccharomyces cerevisiae for large numbers of mitochondrial point mutations which affect structure and function of catalytic subunits of cytochrome-c oxidase.
Eur J Biochem 1993 Apr 1;213(1):129-35
PMID: 8386619
Decoster E, Vassal A, Faye G
MSS1, a nuclear-encoded mitochondrial GTPase involved in the expression of COX1 subunit of cytochrome c oxidase.
J Mol Biol 1993 Jul 5;232(1):79-88
PMID: 8392589
Lepingle A, Casaregola S, Neuveglise C, Bon E, Nguyen H, Artiguenave F, Wincker P, Gaillardin C
Genomic exploration of the hemiascomycetous yeasts: 14. Debaryomyces hansenii var. hansenii.
FEBS Lett 2000 Dec 22;487(1):82-6
PMID: 11152889
Robineau S, Bergantino E, Carignani G, Michel F, Netter P
Suppressors of cis-acting splicing-deficient mutations that affect the ribozyme core of a group II intron.
J Mol Biol 1997 Apr 4;267(3):537-47
PMID: 9126836
Lopez V, Fernandez-Espinar MT, Barrio E, Ramon D, Querol A
A new PCR-based method for monitoring inoculated wine fermentations.
Int J Food Microbiol 2003 Feb 25;81(1):63-71
PMID: 12423919
Guzelin E, Rep M, Grivell LA
Afg3p, a mitochondrial ATP-dependent metalloprotease, is involved in degradation of mitochondrially-encoded Cox1, Cox3, Cob, Su6, Su8 and Su9 subunits of the inner membrane complexes III, IV and V.
FEBS Lett 1996 Feb 26;381(1-2):42-6
PMID: 8641436
Winter AJ, Groot Koerkamp MJ, Tabak HF
Splice site selection by intron aI3 of the COX1 gene from Saccharomyces cerevisiae.
Nucleic Acids Res 1992 Aug 11;20(15):3897-904
PMID: 1324471
Colby G, Wu M, Tzagoloff A
MTO1 codes for a mitochondrial protein required for respiration in paromomycin-resistant mutants of Saccharomyces cerevisiae.
J Biol Chem 1998 Oct 23;273(43):27945-52
PMID: 9774408
Rodeheffer MS, Boone BE, Bryan AC, Shadel GS
Nam1p, a protein involved in RNA processing and translation, is coupled to transcription through an interaction with yeast mitochondrial RNA polymerase.
J Biol Chem 2001 Mar 16;276(11):8616-22
PMID: 11118450
Fernet CS, Clark-Walker GD, Claisse ML
The mitochondrial genome can be altered or lost without lethal effect in the petite-negative yeast Debaryomyces ( Schwanniomyces) occidentalis.
Curr Genet 2002 Nov;42(2):94-102
PMID: 12478388
Misiewicz MH, Kotylak Z
The genetic mapping of the OXI3 mitochondrial region.
Acta Microbiol Pol 1982;31(3-4):239-48
PMID: 6189373
Kreike J, Schulze M, Pillar T, Korte A, Rodel G
Cloning of a nuclear gene MRS1 involved in the excision of a single group I intron (bI3) from the mitochondrial COB transcript in S. cerevisiae.
Curr Genet 1986;11(3):185-91
PMID: 2834089
Faugeron-Fonty G, Le Van Kim C, de Zamaroczy M, Goursot R, Bernardi G
A comparative study of the ori sequences from the mitochondrial genomes of twenty wild-type yeast strains.
Gene 1984 Dec;32(3):459-73
PMID: 6397407
Hanson DK, Lamb MR, Mahler HR, Perlman PS
Evidence for translated intervening sequences in the mitochondrial genome of Saccharomyces cerevisiae.
J Biol Chem 1982 Mar 25;257(6):3218-24
PMID: 6277926
Herbert CJ, Labouesse M, Dujardin G, Slonimski PP
The NAM2 proteins from S. cerevisiae and S. douglasii are mitochondrial leucyl-tRNA synthetases, and are involved in mRNA splicing.
EMBO J 1988 Feb;7(2):473-83
PMID: 3284745
Dhawale S, Hanson DK, Alexander NJ, Perlman PS, Mahler HR
Regulatory interactions between mitochondrial genes: interactions between two mosaic genes.
Proc Natl Acad Sci U S A 1981 Mar;78(3):1778-82
PMID: 6262825
Waring RB, Davies RW, Lee S, Grisi E, Berks MM, Scazzocchio C
The mosaic organization of the apocytochrome b gene of Aspergillus nidulans revealed by DNA sequencing.
Cell 1981 Nov;27(1 Pt 2):4-11
PMID: 7034966
Carignani G, Groudinsky O, Frezza D, Schiavon E, Bergantino E, Slonimski PP
An mRNA maturase is encoded by the first intron of the mitochondrial gene for the subunit I of cytochrome oxidase in S. cerevisiae.
Cell 1983 Dec;35(3 Pt 2):733-42
PMID: 6317200
Simon M, Faye G
Organization and processing of the mitochondrial oxi3/oli2 multigenic transcript in yeast.
Mol Gen Genet 1984;196(2):266-74
PMID: 6387398
Netter P, Jacq C, Carignani G, Slonimski PP
Critical sequences within mitochondrial introns: cis-dominant mutations of the "cytochrome-b-like" intron of the oxidase gene.
Cell 1982 Apr;28(4):733-8
PMID: 6284371
Macreadie IG, Novitski CE, Maxwell RJ, John U, Ooi BG, McMullen GL, Lukins HB, Linnane AW, Nagley P
Biogenesis of mitochondria: the mitochondrial gene (aap1) coding for mitochondrial ATPase subunit 8 in Saccharomyces cerevisiae.
Nucleic Acids Res 1983 Jul 11;11(13):4435-51
PMID: 6223276
Labouesse M, Slonimski PP
Construction of novel cytochrome b genes in yeast mitochondria by subtraction or addition of introns.
EMBO J 1983;2(2):269-76
PMID: 11894937
Labouesse M, Dujardin G, Slonimski PP
The yeast nuclear gene NAM2 is essential for mitochondrial DNA integrity and can cure a mitochondrial RNA-maturase deficiency.
Cell 1985 May;41(1):133-43
PMID: 2986842
Lamb MR, Anziano PQ, Glaus KR, Hanson DK, Klapper HJ, Perlman PS, Mahler HR
Functional domains in introns. RNA processing intermediates in cis- and trans-acting mutants in the penultimate intron of the mitochondrial gene for cytochrome b.
J Biol Chem 1983 Feb 10;258(3):1991-9
PMID: 6296117
Johnston SA, Anziano PQ, Shark K, Sanford JC, Butow RA
Mitochondrial transformation in yeast by bombardment with microprojectiles.
Science 1988 Jun 10;240(4858):1538-41
PMID: 2836954
Heude M, Fukuhara H, Moustacchi E
Spontaneous and induced rho mutants of Saccharomyces cerevisiae: patterns of loss of mitochondrial genetic markers.
J Bacteriol 1979 Aug;139(2):460-70
PMID: 378973
Netter P, Carignani G, Jacq C, Groudinsky O, Clavilier L, Slonimski PP
The cytochrome oxidase subunit I split gene in Saccharomyces cerevisiae: genetic and physical studies of the mtDNA segment encompassing the 'cytochrome b-homologous' intron.
Mol Gen Genet 1982;188(1):51-9
PMID: 6294481
Wright RM, Horrum MA, Cummings DJ
Are mitochondrial structural genes selectively amplified during senescence in Podospora anserina?
Cell 1982 Jun;29(2):505-15
PMID: 6288260
Carignani G, Dujardin G, Slonimski PP
Petite deletion map of the mitochondrial oxi3 region in Saccharomyces cerevisiae.
Mol Gen Genet 1979 Jan 2;167(3):301-8
PMID: 216902
Zennaro E, Grimaldi L, Baldacci G, Frontali L
Mitochondrial transcription and processing of transcripts during release from glucose repression in 'resting cells' of Saccharomyces cerevisiae.
Eur J Biochem 1985 Feb 15;147(1):191-6
PMID: 2578960
Schmelzer C, Schmidt C, May K, Schweyen RJ
Determination of functional domains in intron bI1 of yeast mitochondrial RNA by studies of mitochondrial mutations and a nuclear suppressor.
EMBO J 1983;2(11):2047-52
PMID: 6357781
Baldacci G, Zennaro E
Mitochondrial transcripts in glucose-repressed cells of Saccharomyces cerevisiae.
Eur J Biochem 1982 Oct;127(2):411-6
PMID: 6754381
Weiller GF, Bruckner H, Kim SH, Pratje E, Schweyen RJ
A GC cluster repeat is a hotspot for mit- macro-deletions in yeast mitochondrial DNA.
Mol Gen Genet 1991 Apr;226(1-2):233-40
PMID: 1851950
Labouesse M, Netter P, Schroeder R
Molecular basis of the 'box effect', A maturase deficiency leading to the absence of splicing of two introns located in two split genes of yeast mitochondrial DNA.
Eur J Biochem 1984 Oct 1;144(1):85-93
PMID: 6207024
Bergantino E, Carignani G
A controversy concerning the structure of the mitochondrial genome of a yeast petite mutant: resolution by sequence analysis.
Curr Genet 1989 Apr;15(4):291-3; discussion 293-4
PMID: 2546686
Hanson DK, Miller DH, Mahler HR, Alexander NJ, Perlman PS
Regulatory interaction between mitochondrial genes. II. Detailed characterization of novel mutants mapping within one cluster in the cob2 region.
J Biol Chem 1979 Apr 10;254(7):2480-90
PMID: 218940
Groudinsky O, Dujardin G, Slonimski PP
Long range control circuits within mitochondria and between nucleus and mitochondria. II. Genetic and biochemical analyses of suppressors which selectively alleviate the mitochondrial intron mutations.
Mol Gen Genet 1981;184(3):493-503
PMID: 7038398
Pratje E, Schulz R, Schnierer S, Michaelis G
Sporulation of mitochondrial respiratory deficient mit- mutants of Saccharomyces cerevisiae.
Mol Gen Genet 1979 Nov;176(3):411-5
PMID: 392241
Muller PP, Reif MK, Zonghou S, Sengstag C, Mason TL, Fox TD
A nuclear mutation that post-transcriptionally blocks accumulation of a yeast mitochondrial gene product can be suppressed by a mitochondrial gene rearrangement.
J Mol Biol 1984 Jun 5;175(4):431-52
PMID: 6330366
Netter P, Robineau S, Sirand-Pugnet P, Fauvarque MO
The unusual reversion properties of a mitochondrial mutation in the structural gene of subunit I of cytochrome oxidase of Saccharomyces cerevisiae reveal a probable histidine ligand of the redox center.
Curr Genet 1992 Feb;21(2):147-51
PMID: 1314705
de Zamaroczy M, Bernardi G
The mosaic organization of the mitochondrial introns of Saccharomyces cerevisiae: features and evolutionary origins.
Gene 1992 Dec 1;122(1):91-9
PMID: 1452043
Carignani G, Netter P, Bergantino E, Robineau S
Expression of the mitochondrial split gene coding for cytochrome oxidase subunit I in S. cerevisiae: RNA splicing pathway.
Curr Genet 1986;11(1):55-63
PMID: 2834080
Kruszewska A, Szczesniak B
Functional nuclear suppressor of mitochondrial oxi2 mutations in yeast.
Curr Genet 1985;10(2):87-93
PMID: 2842069
Seraphin B, Simon M, Faye G
A mitochondrial reading frame which may code for a maturase-like protein in Saccharomyces cerevisiae.
Nucleic Acids Res 1985 Apr 25;13(8):3005-14
PMID: 2987871
Bonitz SG, Coruzzi G, Thalenfeld BE, Tzagoloff A, Macino G
Assembly of the mitochondrial membrane system. Physical map of the Oxi3 locus of yeast mitochondrial DNA.
J Biol Chem 1980 Dec 25;255(24):11922-6
PMID: 6254985
Hensgens LA, Van der Horst G, Grivell LA
Interaction between mitochondrial genes in yeast: evidence for novel box effect(s).
Plasmid 1984 Jul;12(1):41-51
PMID: 6093170
Tian GL, Macadre C, Kruszewska A, Szczesniak B, Ragnini A, Grisanti P, Rinaldi T, Palleschi C, Frontali L, Slonimski PP, et al
Incipient mitochondrial evolution in yeasts. I. The physical map and gene order of Saccharomyces douglasii mitochondrial DNA discloses a translocation of a segment of 15,000 base-pairs and the presence of new introns in comparison with Saccharomyces cerevisiae.
J Mol Biol 1991 Apr 20;218(4):735-46
PMID: 1850804
Dickson L, Huang HR, Liu L, Matsuura M, Lambowitz AM, Perlman PS
Retrotransposition of a yeast group II intron occurs by reverse splicing directly into ectopic DNA sites.
Proc Natl Acad Sci U S A 2001 Nov 6;98(23):13207-12
PMID: 11687644
Yang J, Mohr G, Perlman PS, Lambowitz AM
Group II intron mobility in yeast mitochondria: target DNA-primed reverse transcription activity of aI1 and reverse splicing into DNA transposition sites in vitro.
J Mol Biol 1998 Sep 25;282(3):505-23
PMID: 9737919
Levra-Juillet E, Boulet A, Seraphin B, Simon M, Faye G
Mitochondrial introns aI1 and/or aI2 are needed for the in vivo deletion of intervening sequences.
Mol Gen Genet 1989 May;217(1):168-71
PMID: 2475753
Moran JV, Zimmerly S, Eskes R, Kennell JC, Lambowitz AM, Butow RA, Perlman PS
Mobile group II introns of yeast mitochondrial DNA are novel site-specific retroelements.
Mol Cell Biol 1995 May;15(5):2828-38
PMID: 7537853
van der Veen R, de Haan M, Grivell LA
RNA splicing in yeast mitochondria: DNA sequence analysis of mit- mutants deficient in the excision of introns aI1 and aI2 of the gene for subunit I of cytochrome c oxidase.
Curr Genet 1988 Mar;13(3):219-26
PMID: 2838183
Bergantino E, Carignani G
Antibodies against a fused gene product identify the protein encoded by a group II yeast mitochondrial intron.
Mol Gen Genet 1990 Sep;223(2):249-57
PMID: 1701209
Lazowska J, Meunier B, Macadre C
Homing of a group II intron in yeast mitochondrial DNA is accompanied by unidirectional co-conversion of upstream-located markers.
EMBO J 1994 Oct 17;13(20):4963-72
PMID: 7525273
Herbert CJ, Macadre C, Becam AM, Lazowska J, Slonimski PP
The MRS1 gene of S. douglasii: co-evolution of mitochondrial introns and specific splicing proteins encoded by nuclear genes.
Gene Expr 1992;2(3):203-14
PMID: 1333316
Boguta M, Mieszczak M, Zagorski W
Nuclear omnipotent suppressors of premature termination codons in mitochondrial genes affect the 37S mitoribosomal subunit.
Curr Genet 1988 Feb;13(2):129-35
PMID: 3286020
Schmelzer C, Schmidt C, Schweyen RJ
Identification of splicing signals in introns of yeast mitochondrial split genes: mutational alterations in intron bI1 and secondary structures in related introns.
Nucleic Acids Res 1982 Nov 11;10(21):6797-808
PMID: 6294615
Zimmerly S, Guo H, Perlman PS, Lambowitz AM
Group II intron mobility occurs by target DNA-primed reverse transcription.
Cell 1995 Aug 25;82(4):545-54
PMID: 7664334
Guo H, Zimmerly S, Perlman PS, Lambowitz AM
Group II intron endonucleases use both RNA and protein subunits for recognition of specific sequences in double-stranded DNA.
EMBO J 1997 Nov 17;16(22):6835-48
PMID: 9362497
Van Dyck L, Langer T
ATP-dependent proteases controlling mitochondrial function in the yeast Saccharomyces cerevisiae.
Cell Mol Life Sci 1999 Nov 30;56(9-10):825-42
PMID: 11212342
Moran JV, Mecklenburg KL, Sass P, Belcher SM, Mahnke D, Lewin A, Perlman P
Splicing defective mutants of the COXI gene of yeast mitochondrial DNA: initial definition of the maturase domain of the group II intron aI2.
Nucleic Acids Res 1994 Jun 11;22(11):2057-64
PMID: 8029012
Mink M
Indication for deletion of two introns in the oxi-3 gene of a respiratory-competent Saccharomyces cerevisiae strain.
Biochem Genet 1988 Aug;26(7-8):503-10
PMID: 3067726
Rho SB, Martinis SA
The bI4 group I intron binds directly to both its protein splicing partners, a tRNA synthetase and maturase, to facilitate RNA splicing activity.
RNA 2000 Dec;6(12):1882-94
PMID: 11142386
Cummings DJ, Michel F, McNally KL
DNA sequence analysis of the 24.5 kilobase pair cytochrome oxidase subunit I mitochondrial gene from Podospora anserina: a gene with sixteen introns.
Curr Genet 1989 Dec;16(5-6):381-406
PMID: 2558809
Borghouts C, Kimpel E, Osiewacz HD
Mitochondrial DNA rearrangements of Podospora anserina are under the control of the nuclear gene grisea.
Proc Natl Acad Sci U S A 1997 Sep 30;94(20):10768-73
PMID: 9380708
Borghouts C, kerschner S, Osiewacz HD
Copper-dependence of mitochondrial DNA rearrangements in Podospora anserina.
Curr Genet 2000 Apr;37(4):268-75
PMID: 10803888
Matsuura ET, Domenico JM, Cummings DJ
An additional class II intron with homology to reverse transcriptase in rapidly senescing Podospora anserina.
Curr Genet 1986;10(12):915-22
PMID: 2452024
Kuck U, Osiewacz HD, Schmidt U, Kappelhoff B, Schulte E, Stahl U, Esser K
The onset of senescence is affected by DNA rearrangements of a discontinuous mitochondrial gene in Podospora anserina.
Curr Genet 1985;9(5):373-82
PMID: 2836091
Schmidt U, Sagebarth R, Schmelzer C, Stahl U
Self-splicing of a Podospora anserina group IIA intron in vitro. Effects of 3'-terminal intron alterations on cleavage at the 5' and 3' splice site.
J Mol Biol 1993 Jun 5;231(3):559-68
PMID: 8515440
Schmidt U, Riederer B, Morl M, Schmelzer C, Stahl U
Self-splicing of the mobile group II intron of the filamentous fungus Podospora anserina (COI I1) in vitro.
EMBO J 1990 Jul;9(7):2289-98
PMID: 2162769
Lang BF, Ahne F, Bonen L
The mitochondrial genome of the fission yeast Schizosaccharomyces pombe. The cytochrome b gene has an intron closely related to the first two introns in the Saccharomyces cerevisiae cox1 gene.
J Mol Biol 1985 Aug 5;184(3):353-66
PMID: 4046021
Zimmer M, Welser F, Oraler G, Wolf K
Distribution of mitochondrial introns in the species Schizosaccharomyces pombe and the origin of the group II intron in the gene encoding apocytochrome b.
Curr Genet 1987;12(5):329-36
PMID: 3446375
Trinkl H, Wolf K
The mosaic cox1 gene in the mitochondrial genome of Schizosaccharomyces pombe: minimal structural requirements and evolution of group I introns.
Gene 1986;45(3):289-97
PMID: 3026914
Ahne A, Muller-Derlich J, Merlos-Lange AM, Kanbay F, Wolf K, Lang BF
Two distinct mechanisms for deletion in mitochondrial DNA of Schizosaccharomyces pombe mutator strains. Slipped mispairing mediated by direct repeats and erroneous intron splicing.
J Mol Biol 1988 Aug 20;202(4):725-34
PMID: 3172236
Lang BF, Wolf K
The mitochondrial genome of the fission yeast Schizosaccharomyces pombe. 2. Localization of genes by interspecific hybridization in strain ade7-50h- and cloning of the genome in small fragments.
Mol Gen Genet 1984;196(3):465-72
PMID: 6094974
Schafer B, Merlos-Lange AM, Anderl C, Welser F, Zimmer M, Wolf K
The mitochondrial genome of fission yeast: inability of all introns to splice autocatalytically, and construction and characterization of an intronless genome.
Mol Gen Genet 1991 Jan;225(1):158-67
PMID: 1705653
Hausner G, Monteiro-Vitorello CB, Searles DB, Maland M, Fulbright DW, Bertrand H
A long open reading frame in the mitochondrial LSU rRNA group-I intron of Cryphonectria parasitica encodes a putative S5 ribosomal protein fused to a maturase.
Curr Genet 1999 Mar;35(2):109-17
PMID: 10079329
San Filippo J, Lambowitz AM
Characterization of the C-terminal DNA-binding/DNA endonuclease region of a group II intron-encoded protein.
J Mol Biol 2002 Dec 13;324(5):933-51
PMID: 12470950
Dunny GM, McKay LL
Group II introns and expression of conjugative transfer functions in lactic acid bacteria.
Antonie Van Leeuwenhoek 1999 Jul-Nov;76(1-4):77-88
PMID: 10532373
Cousineau B, Lawrence S, Smith D, Belfort M
Retrotransposition of a bacterial group II intron.
Nature 2000 Apr 27;404(6781):1018-21
PMID: 10801134
Singh RN, Saldanha RJ, D'Souza LM, Lambowitz AM
Binding of a group II intron-encoded reverse transcriptase/maturase to its high affinity intron RNA binding site involves sequence-specific recognition and autoregulates translation.
J Mol Biol 2002 Apr 26;318(2):287-303
PMID: 12051838
Zhou L, Manias DA, Dunny GM
Regulation of intron function: efficient splicing in vivo of a bacterial group II intron requires a functional promoter within the intron.
Mol Microbiol 2000 Aug;37(3):639-51
PMID: 10931357
Matsuura M, Saldanha R, Ma H, Wank H, Yang J, Mohr G, Cavanagh S, Dunny GM, Belfort M, Lambowitz AM
A bacterial group II intron encoding reverse transcriptase, maturase, and DNA endonuclease activities: biochemical demonstration of maturase activity and insertion of new genetic information within the intron.
Genes Dev 1997 Nov 1;11(21):2910-24
PMID: 9353259
Ichiyanagi K, Beauregard A, Lawrence S, Smith D, Cousineau B, Belfort M
Retrotransposition of the Ll.LtrB group II intron proceeds predominantly via reverse splicing into DNA targets.
Mol Microbiol 2002 Dec;46(5):1259-72
PMID: 12453213
Saldanha R, Chen B, Wank H, Matsuura M, Edwards J, Lambowitz AM
RNA and protein catalysis in group II intron splicing and mobility reactions using purified components.
Biochemistry 1999 Jul 13;38(28):9069-83
PMID: 10413481
Mills DA, McKay LL, Dunny GM
Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci.
J Bacteriol 1996 Jun;178(12):3531-8
PMID: 8655550
Wank H, SanFilippo J, Singh RN, Matsuura M, Lambowitz AM
A reverse transcriptase/maturase promotes splicing by binding at its own coding segment in a group II intron RNA.
Mol Cell 1999 Aug;4(2):239-50
PMID: 10488339
Cousineau B, Smith D, Lawrence-Cavanagh S, Mueller JE, Yang J, Mills D, Manias D, Dunny G, Lambowitz AM, Belfort M
Retrohoming of a bacterial group II intron: mobility via complete reverse splicing, independent of homologous DNA recombination.
Cell 1998 Aug 21;94(4):451-62
PMID: 9727488
Sone T, Fujisawa M, Takenaka M, Nakagawa S, Yamaoka S, Sakaida M, Nishiyama R, Yamato KT, Ohmido N, Fukui K, Fukuzawa H, Ohyama K
Bryophyte 5S rDNA was inserted into 45S rDNA repeat units after the divergence from higher land plants.
Plant Mol Biol 1999 Nov;41(5):679-85
PMID: 10645727
Kranz HD, Miks D, Siegler ML, Capesius I, Sensen CW, Huss VA
The origin of land plants: phylogenetic relationships among charophytes, bryophytes, and vascular plants inferred from complete small-subunit ribosomal RNA gene sequences.
J Mol Evol 1995 Jul;41(1):74-84
PMID: 7608991
Cummings DJ, Michel F, Domenico JM, McNally KL
DNA sequence analysis of the mitochondrial ND4L-ND5 gene complex from Podospora anserina. Duplication of the ND4L gene within its intron.
J Mol Biol 1990 Mar 20;212(2):269-86
PMID: 2319602
Cummings DJ, Michel F, Domenico JM, McNally KL
Mitochondrial DNA sequence analysis of the cytochrome oxidase subunit II gene from Podospora anserina. A group IA intron with a putative alternative splice site.
J Mol Biol 1990 Mar 20;212(2):287-94
PMID: 2157023
Umesono K, Inokuchi H, Shiki Y, Takeuchi M, Chang Z, Fukuzawa H, Kohchi T, Shirai H, Ohyama K, Ozeki H
Structure and organization of Marchantia polymorpha chloroplast genome. II. Gene organization of the large single copy region from rps'12 to atpB.
J Mol Biol 1988 Sep 20;203(2):299-331
PMID: 2974085

Options:

Limit of E-value: 1e-20
Limit of Length: 100000
Limit of references returned each search: 40
Limit of retry times: 3
Direct references: Yes
Indirect references: Yes
Allow symbol with hyphen: Yes
Use stop word list: Yes
Thesaurus:
- Escherichia coli (Version: 6.5.0)
- Saccharomyces cerevisiae (Version: 20021123.0)




 
BLASTN 2.2.5 [Nov-16-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
RID: 1048227809-027572-18192
Query= 
         (2505 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences) 
           1,707,549 sequences; 7,931,913,529 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|559273|gb|L36897.1|YSCMTCG13 Saccharomyces cerevisiae mitocho...  2518   0.0  
gi|4160362|emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae com...  2518   0.0  
gi|13523|emb|V00694.1|MISC13 Saccharomyces cerevisiae mitochondr...  2518   0.0  
gi|13584|emb|X14910.1|MISCOXI3 Yeast mitochondrial oxi3 gene exo...   347   5e-92
gi|13568|emb|Z11698.1|MISCMATIN S.cerevisiae mitochondrion matur...   327   5e-86
gi|436896|gb|U00801.1|SCU00801 Saccharomyces capensis subunit I ...   319   1e-83
gi|294042|gb|M97514.1|YSCMTCYTOC Saccharomyces douglasii mitocho...   295   2e-76
gi|343888|gb|J01508.1|YSCMTP201 Yeast (S.cerevisiae) mitochondri...   184   4e-43
gi|21105284|gb|AF437291.1| Saccharomyces castellii strain NRRL Y...   168   3e-38
gi|13018|emb|X57546.1|MIKLCOX1 K.lactis mitochondrial COX1 and A...   129   2e-26
gi|8980427|emb|X15999.2|MIKLCOX2 Kluyveromyces lactis mitochondr...    86   3e-13
gi|1000971|dbj|D31785.1|HASMT Pichia canadensis mitochondrial DN...    84   1e-12
gi|343889|gb|J01509.1|YSCMTP202 Yeast (S.cerevisiae) mitochondri...    56   3e-04
gi|13639|emb|X54421.1|MISPCG Schizosaccharomyces pombe complete ...    52   0.004
gi|13648|emb|X02819.1|MISPCOB Fission yeast cob gene for cytochr...    52   0.004
gi|11121010|emb|AL159161.11| Human DNA sequence from clone RP11-...    50   0.017
gi|3845302|gb|AE001423.1| Plasmodium falciparum 3D7 chromosome 2...    48   0.066
gi|22004169|gb|AC011447.7| Homo sapiens chromosome 19 clone CTC-...    48   0.066
gi|20800407|gb|AC110089.5| Homo sapiens BAC clone RP11-806P14 fr...    48   0.066
gi|20516925|gb|AE013142.1| Thermoanaerobacter tengcongensis stra...    48   0.066
gi|12325073|gb|AC018364.5|AC018364 Arabidopsis thaliana chromoso...    48   0.066
gi|7684581|gb|AC007284.4|AC007284 Homo sapiens BAC clone RP11-55...    48   0.066
gi|5757471|gb|AC008262.4|AC008262 Genomic sequence for Arabidops...    48   0.066
gi|26347908|dbj|AK079306.1| Mus musculus 16 days neonate cerebel...    48   0.066
gi|487594|gb|U09206.1|YMU09206 Yponomeuta malinellus mitochondri...    48   0.066
gi|3127201|gb|AF062314.1|AF062314 Tegeticula yuccasella cytochro...    48   0.066
gi|3127197|gb|AF062312.1|AF062312 Tegeticula yuccasella cytochro...    48   0.066
gi|4559317|gb|AC007204.1|AC007204 Homo sapiens chromosome 19, BA...    48   0.066
gi|23095789|emb|AL670260.10| Mouse DNA sequence from clone RP23-...    48   0.066
gi|25281353|gb|AC024057.5| Homo sapiens chromosome 3 clone RP11-...    46   0.26 
gi|22218442|gb|AC068644.15| Homo sapiens 3 BAC RP11-315J22 (Rosw...    46   0.26 
gi|24080638|gb|AC087427.3| Homo sapiens chromosome 3 clone RP11-...    46   0.26 
gi|3845197|gb|AE001398.1| Plasmodium falciparum 3D7 chromosome 2...    46   0.26 
gi|19774318|gb|AC108706.2| Homo sapiens 3 BAC RP11-43A1 (Roswell...    46   0.26 
gi|19482366|gb|AC109347.3| Homo sapiens BAC clone RP11-73K9 from...    46   0.26 
gi|19033958|gb|AC007239.3| Homo sapiens BAC clone RP11-83A12 fro...    46   0.26 
gi|16756324|gb|AC093758.3| Homo sapiens BAC clone RP11-66L22 fro...    46   0.26 
gi|15638737|gb|AC073885.5| Homo sapiens BAC clone RP11-70L16 fro...    46   0.26 
gi|2791346|emb|AL008707.1|HS161N10 Human DNA sequence from clone...    46   0.26 
gi|16973974|emb|AL603747.5| Zebrafish DNA sequence from clone BU...    46   0.26 
gi|28208114|emb|AL831712.12| Mouse DNA sequence from clone RP23-...    46   0.26 
gi|23504903|emb|AL929355.1|PFA929355 Plasmodium falciparum strai...    46   0.26 
gi|26185516|emb|AL928650.5| Zebrafish DNA sequence from clone CH...    46   0.26 
gi|12831357|gb|AC087083.2|AC087083 Homo sapiens chromosome 3 clo...    46   0.26 
gi|26342109|dbj|AK051678.1| Mus musculus 12 days embryo spinal g...    46   0.26 
gi|14270137|emb|AL161912.15| Human DNA sequence from clone RP11-...    46   0.26 
gi|20177257|emb|AL645846.12| Mouse DNA sequence from clone RP23-...    46   0.26 
gi|28829949|gb|AC116957.2| Dictyostelium discoideum chromosome 2...    44   1.0  
gi|28416292|gb|AC122206.4| Mus musculus chromosome 8 clone RP23-...    44   1.0  
gi|28204047|gb|AE015943.1| Clostridium tetani E88, section 8 of ...    44   1.0  
gi|27777573|gb|AC010336.8| Homo sapiens chromosome 19 clone CTD-...    44   1.0  
gi|24757118|gb|AC073446.16| Homo sapiens chromosome 15, clone RP...    44   1.0  
gi|24211410|gb|AC100754.8| Homo sapiens chromosome 15, clone RP1...    44   1.0  
gi|24137578|gb|AC100755.8| Homo sapiens chromosome 15, clone RP1...    44   1.0  
gi|22795199|gb|AC084324.8| Mus musculus Strain C57BL6/J chromoso...    44   1.0  
gi|22653602|gb|AC100756.4| Homo sapiens chromosome 18, clone RP1...    44   1.0  
gi|22213523|gb|AC121835.2| Mus musculus chromosome 8 clone RP24-...    44   1.0  
gi|21700642|gb|AC091078.7| Homo sapiens, clone RP11-164C12, comp...    44   1.0  
gi|21747464|gb|AC092329.3| Homo sapiens chromosome 19 clone RP11...    44   1.0  
gi|20043183|gb|AC110023.3| Homo sapiens chromosome 15, clone RP1...    44   1.0  
gi|19852151|gb|AC021321.11| Homo sapiens chromosome 8, clone RP1...    44   1.0  
gi|16924148|gb|AC092576.3| Homo sapiens BAC clone RP11-7N16 from...    44   1.0  
gi|18464229|gb|AC027506.12| Homo sapiens chromosome 18, clone RP...    44   1.0  
gi|17488685|gb|AC011037.8| Homo sapiens chromosome 8, clone RP11...    44   1.0  
gi|4826541|emb|AL049549.3|HS64I15 Human DNA sequence from clone ...    44   1.0  
gi|13443263|gb|AC067947.6| Homo sapiens BAC clone RP11-492I5 fro...    44   1.0  
gi|13493156|gb|AC012001.6| Homo sapiens BAC clone RP11-465G21 fr...    44   1.0  
gi|15281187|gb|AC008936.6| Homo sapiens chromosome 5 clone CTD-2...    44   1.0  
gi|13435268|gb|AC013401.10|AC013401 Homo sapiens BAC clone RP11-...    44   1.0  
gi|13876492|gb|AC022433.5|AC022433 Homo sapiens chromosome 5 clo...    44   1.0  
gi|24366692|emb|AL928623.5| Mouse DNA sequence from clone RP23-2...    44   1.0  
gi|7269897|emb|AL161576.2|ATCHRIV72 Arabidopsis thaliana DNA chr...    44   1.0  
gi|5730125|emb|AL109796.1|ATF9N11 Arabidopsis thaliana DNA chrom...    44   1.0  
gi|5931443|gb|AC007685.2|AC007685 Homo sapiens BAC clone RP11-55...    44   1.0  
gi|4156158|gb|AC005230.1|AC005230 Homo sapiens PAC clone RP5-116...    44   1.0  
gi|6468459|emb|AJ251292.1|SPO251292 Schizosaccharomyces pombe mi...    44   1.0  
gi|14625383|dbj|AP001547.4| Homo sapiens genomic DNA, chromosome...    44   1.0  
gi|9558577|gb|AC008812.7|AC008812 Homo sapiens chromosome 19 clo...    44   1.0  
gi|6465823|emb|AL035425.13|HS24A23 Human DNA sequence from clone...    44   1.0  
gi|16944348|emb|AL445903.3|CNS07EEU Human chromosome 14 DNA sequ...    44   1.0  
gi|14272293|emb|AL356866.22| Human DNA sequence from clone RP11-...    44   1.0  
gi|12666215|emb|AL139376.17| Human DNA sequence from clone RP11-...    44   1.0  
gi|26094032|dbj|AK050645.1| Mus musculus 2 days neonate thymus t...    44   1.0  
gi|26090601|dbj|AK044903.1| Mus musculus 9.5 days embryo parthen...    44   1.0  
gi|22779465|dbj|AP003150.1| Mus musculus genomic DNA, chromosome...    44   1.0  
gi|4049647|gb|AF063866.1|AF063866 Melanoplus sanguinipes entomop...    44   1.0  
gi|3927856|gb|AC005920.1|AC005920 Homo sapiens chromosome 17, cl...    44   1.0  
gi|22552818|emb|AL672033.12| Mouse DNA sequence from clone RP23-...    44   1.0  
gi|21436666|emb|AL096705.13|HSJ1085J7 Human DNA sequence from cl...    44   1.0  
gi|19263034|dbj|AP003064.2| Homo sapiens genomic DNA, chromosome...    44   1.0  
gi|28973953|gb|AC127422.4| Mus musculus chromosome 9 clone RP24-...    42   4.1  
gi|28973836|gb|AC018635.9| Homo sapiens chromosome 7 clone RP11-...    42   4.1  
gi|28829751|gb|AC116305.2| Dictyostelium discoideum chromosome 2...    42   4.1  
gi|28829732|gb|AC116925.2| Dictyostelium discoideum chromosome 2...    42   4.1  
gi|28882246|gb|AC138710.5| Homo sapiens chromosome 17, clone RP1...    42   4.1  
gi|28867182|gb|AC127254.3| Mus musculus chromosome 9 clone RP24-...    42   4.1  
gi|15636666|gb|BC012288.1| Homo sapiens, clone IMAGE:2900205, mRNA     42   4.1  
gi|28626602|gb|AC078802.14| Homo sapiens 3 BAC RP11-816J6 (Roswe...    42   4.1  
gi|28416269|gb|AC132337.3| Mus musculus chromosome 6 clone RP24-...    42   4.1  
gi|22831713|gb|AE003433.3| Drosophila melanogaster chromosome X ...    42   4.1  

ALIGNMENTS
>gi|559273|gb|L36897.1|YSCMTCG13 Saccharomyces cerevisiae mitochondrion oxi3 gene, aapI gene, oli2
            gene, ORF4, replication of origin (ori7 and ori2), and
            ORF5
          Length = 21153

 Score = 2518 bits (1270), Expect = 0.0
 Identities = 1284/1291 (99%)
 Strand = Plus / Plus

                                                                        
Query: 801  tagaattaagagtaaacctggtaatataactccaggtacaacattagaaacattagatgg 860
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 927  tagaattaagagtaaacctggtaatataactccaggtacaacattagaaacattagatgg 986

                                                                        
Query: 861  tataaatataatatatttaaataaattatcaaatgaattaggaacaggtaaattcaaatt 920
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 987  tataaatataatatatttaaataaattatcaaatgaattaggaacaggtaaattcaaatt 1046

                                                                        
Query: 921  taaacccatgagaatagttaatattcctaaacctaaaggtggtataagacctttaagtgt 980
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1047 taaacccatgagaatagttaatattcctaaacctaaaggtggtataagacctttaagtgt 1106

                                                                        
Query: 981  aggtaatccaagagataaaattgtacaagaagttataagaataattttagatacaatttt 1040
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1107 aggtaatccaagagataaaattgtacaagaagttataagaataattttagatacaatttt 1166

                                                                        
Query: 1041 tgataaaaagatatcaacacattcacatggttttagaaagaatataagttgtcaaacagc 1100
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1167 tgataaaaagatatcaacacattcacatggttttagaaagaatataagttgtcaaacagc 1226

                                                                        
Query: 1101 aatttgagaagttagaaatatatttggtggaagtaattgatttattgaagtagacttnnn 1160
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 1227 aatttgagaagttagaaatatatttggtggaagtaattgatttattgaagtagacttaaa 1286

                                                                        
Query: 1161 nnnntgttttgatacaatttctcatgatttaattattaaagaattaaaaagatatatttc 1220
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1287 aaaatgttttgatacaatttctcatgatttaattattaaagaattaaaaagatatatttc 1346

                                                                        
Query: 1221 agataaaggttttattgatttagtatataaattattaagagctggttatattgatgagaa 1280
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1347 agataaaggttttattgatttagtatataaattattaagagctggttatattgatgagaa 1406

                                                                        
Query: 1281 aggaacttatcataaacctatattaggtttacctcaaggatcattaattagtcctatctt 1340
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1407 aggaacttatcataaacctatattaggtttacctcaaggatcattaattagtcctatctt 1466

                                                                        
Query: 1341 atgtaatattgtaataacattggtagataattgattagaagattatattaatttatataa 1400
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1467 atgtaatattgtaataacattggtagataattgattagaagattatattaatttatataa 1526

                                                                        
Query: 1401 taaaggtaaagttaaaaaacaacatcctacatataaaaaattatcaagaataattgcaaa 1460
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1527 taaaggtaaagttaaaaaacaacatcctacatataaaaaattatcaagaataattgcaaa 1586

                                                                        
Query: 1461 agctaaaatattttcgacaagattaaaattacataaagaaagagctaaaggcccactatt 1520
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1587 agctaaaatattttcgacaagattaaaattacataaagaaagagctaaaggcccactatt 1646

                                                                        
Query: 1521 tatttataatgatcctaatttcaagagaataaaatacgttagatatgcagatgatatttt 1580
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1647 tatttataatgatcctaatttcaagagaataaaatacgttagatatgcagatgatatttt 1706

                                                                        
Query: 1581 aattggggtattaggttcaaaaaatgattgtaaaataatcaaaagagatttaaacaattt 1640
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1707 aattggggtattaggttcaaaaaatgattgtaaaataatcaaaagagatttaaacaattt 1766

                                                                        
Query: 1641 tttaaattcattaggtttaactataaatgaagaaaaaactttaattacttgtgcaactga 1700
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1767 tttaaattcattaggtttaactataaatgaagaaaaaactttaattacttgtgcaactga 1826

                                                                        
Query: 1701 actaccagcaagatttttaggttataatatttcaattacacctttaaaaagaatacctac 1760
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1827 actaccagcaagatttttaggttataatatttcaattacacctttaaaaagaatacctac 1886

                                                                        
Query: 1761 agttactaaactaattagaggtaaacttattagaagtagaaatacaactagacctattat 1820
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1887 agttactaaactaattagaggtaaacttattagaagtagaaatacaactagacctattat 1946

                                                                        
Query: 1821 taatgcaccaattagagatattatcaataaattagctactaatggatattgtaagcataa 1880
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1947 taatgcaccaattagagatattatcaataaattagctactaatggatattgtaagcataa 2006

                                                                        
Query: 1881 taaaaatggtagaataggagtgcctacaagagtaggtagatgactatatgaagaacctag 1940
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2007 taaaaatggtagaataggagtgcctacaagagtaggtagatgactatatgaagaacctag 2066

                                                                        
Query: 1941 aacaattattaataattataaagcgttaggtagaggtatcttaaattattataaattagc 2000
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2067 aacaattattaataattataaagcgttaggtagaggtatcttaaattattataaattagc 2126

                                                                        
Query: 2001 tactaattataaaagattaagagaaagaatctattacgtattatattattcatgtgtatt 2060
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2127 tactaattataaaagattaagagaaagaatctattacgtattatattattcatgtgtatt 2186

                                           
Query: 2061 aactttagctagtaaatatagattaaaaaca 2091
            |||||||||||||||||||||||||||||||
Sbjct: 2187 aactttagctagtaaatatagattaaaaaca 2217



 Score = 1388 bits (700), Expect = 0.0
 Identities = 706/708 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtacaaagatgattatattcaacaaatgcaaaagatattgcagtattatattttatg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 atggtacaaagatgattatattcaacaaatgcaaaagatattgcagtattatattttatg 186

                                                                       
Query: 61  ttagctatttttagtggtatggcaggaacagcaatgtctttaatcattagattagaatta 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 ttagctatttttagtggtatggcaggaacagcaatgtctttaatcattagattagaatta 246

                                                                       
Query: 121 gctgcacctggttcacaatatttacatggtaattcacaattatttaatggtgcgcctctc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 gctgcacctggttcacaatatttacatggtaattcacaattatttaatggtgcgcctctc 306

                                                                       
Query: 181 agtgcgtatatttcgttgatgcgtctagcattagtattatgaatcatcaatagatactta 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 307 agtgcgtatatttcgttgatgcgtctagcattagtattatgaatcatcaatagatactta 366

                                                                       
Query: 241 aaacatatgactaactcagtaggggctaactttacggggacaatagcatgtcataaaaca 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 367 aaacatatgactaactcagtaggggctaactttacggggacaatagcatgtcataaaaca 426

                                                                       
Query: 301 cctatgattagtgtaggtggagttaagtgttacatggttaggttaacgaacttcttacaa 360
           |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
Sbjct: 427 cctatgattagtgtaggtggagttaagtgttacatggttaggttaacgaacaacttacaa 486

                                                                       
Query: 361 gtctttatcaggattacaatttcctcttatcatttggatatagtaaaacaagtttgatta 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 487 gtctttatcaggattacaatttcctcttatcatttggatatagtaaaacaagtttgatta 546

                                                                       
Query: 421 ttttacgttgaggtaatcagattatgattcattgttttagatagcacaggcagtgtgaaa 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 547 ttttacgttgaggtaatcagattatgattcattgttttagatagcacaggcagtgtgaaa 606

                                                                       
Query: 481 aagatgaaggacctaaataacacaaaaggaaatacgaaaagtgagggatcaactgaaaga 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 607 aagatgaaggacctaaataacacaaaaggaaatacgaaaagtgagggatcaactgaaaga 666

                                                                       
Query: 541 ggaaactctggagttgacagaggtatagtagtaccgaatactcaaataaaaatgagattt 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 667 ggaaactctggagttgacagaggtatagtagtaccgaatactcaaataaaaatgagattt 726

                                                                       
Query: 601 ttaaatcaagttagatactattcagtaaataataatttaaaaatagggaaggataccaat 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 727 ttaaatcaagttagatactattcagtaaataataatttaaaaatagggaaggataccaat 786

                                                           
Query: 661 attgagttatcaaaagatacaagtacttcggacttgttagaatttgag 708
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 787 attgagttatcaaaagatacaagtacttcggacttgttagaatttgag 834



 Score =  557 bits (281), Expect = e-155
 Identities = 281/281 (100%)
 Strand = Plus / Plus

                                                                        
Query: 2225 cagaagctaaagtaactgatccttttgaatatatcgattcaattaaatatatattaccta 2284
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2351 cagaagctaaagtaactgatccttttgaatatatcgattcaattaaatatatattaccta 2410

                                                                        
Query: 2285 cagctaaagctaattttaataaaccttgtagtatttgtaattcaactattgatgtagaaa 2344
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2411 cagctaaagctaattttaataaaccttgtagtatttgtaattcaactattgatgtagaaa 2470

                                                                        
Query: 2345 tacatcatgttaaacaattacatagaggtatattaaaagcacttaaagattatattctag 2404
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2471 tacatcatgttaaacaattacatagaggtatattaaaagcacttaaagattatattctag 2530

                                                                        
Query: 2405 gtagaataattaccataaacagaaaacaaattccattatgtaaacaatgtcatattaaaa 2464
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2531 gtagaataattaccataaacagaaaacaaattccattatgtaaacaatgtcatattaaaa 2590

                                                     
Query: 2465 cacataaaaataaatttaaaaatataggacctggtatataa 2505
            |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2591 cacataaaaataaatttaaaaatataggacctggtatataa 2631



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 967  agacctttaagtgtaggtaatccaagagataaaattgtacaagaagttataagaataatt 1026
            |||||||||||||| || ||||| ||||| |||||||||||||||  ||| |||||||| 
Sbjct: 3640 agacctttaagtgttggaaatcctagagaaaaaattgtacaagaaagtatgagaataata 3699

                 
Query: 1027 ttaga 1031
            |||||
Sbjct: 3700 ttaga 3704



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                             
Query: 2155 gccaattttccaagaaatacttttgataatatc 2187
            |||||||||||||||||||||||||||||||||
Sbjct: 2281 gccaattttccaagaaatacttttgataatatc 2313



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                   
Query: 1221 agataaaggttttattgatttagtatataaattattaagagctggttatattgat 1275
            |||||||||||| || || ||| |||||||||||||||||||||| ||| |||||
Sbjct: 3894 agataaaggtttcatagacttattatataaattattaagagctggatatgttgat 3948



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 231  tagatacttaaaacatatgactaactcagtaggggctaactttacggggacaatagcatg 290
            ||||||| |||| |||||| || || |||| ||||| ||||  |||||||||||||||||
Sbjct: 2910 tagatacgtaaaccatatggcttacccagttggggccaactcaacggggacaatagcatg 2969

                    
Query: 291  tcataaaa 298
             |||||||
Sbjct: 2970 ccataaaa 2977



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                      
Query: 1558 gttagatatgcagatgatattttaattggggtattaggttcaaaaaatgattgtaaaa 1615
            ||||||||||| ||||||||| | ||||| ||| | |||||  | |||||||||||||
Sbjct: 4240 gttagatatgctgatgatattatcattggtgtaatgggttctcataatgattgtaaaa 4297


>gi|4160362|emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome
          Length = 85779

 Score = 2518 bits (1270), Expect = 0.0
 Identities = 1284/1291 (99%)
 Strand = Plus / Plus

                                                                         
Query: 801   tagaattaagagtaaacctggtaatataactccaggtacaacattagaaacattagatgg 860
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14618 tagaattaagagtaaacctggtaatataactccaggtacaacattagaaacattagatgg 14677

                                                                         
Query: 861   tataaatataatatatttaaataaattatcaaatgaattaggaacaggtaaattcaaatt 920
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14678 tataaatataatatatttaaataaattatcaaatgaattaggaacaggtaaattcaaatt 14737

                                                                         
Query: 921   taaacccatgagaatagttaatattcctaaacctaaaggtggtataagacctttaagtgt 980
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14738 taaacccatgagaatagttaatattcctaaacctaaaggtggtataagacctttaagtgt 14797

                                                                         
Query: 981   aggtaatccaagagataaaattgtacaagaagttataagaataattttagatacaatttt 1040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14798 aggtaatccaagagataaaattgtacaagaagttataagaataattttagatacaatttt 14857

                                                                         
Query: 1041  tgataaaaagatatcaacacattcacatggttttagaaagaatataagttgtcaaacagc 1100
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14858 tgataaaaagatatcaacacattcacatggttttagaaagaatataagttgtcaaacagc 14917

                                                                         
Query: 1101  aatttgagaagttagaaatatatttggtggaagtaattgatttattgaagtagacttnnn 1160
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 14918 aatttgagaagttagaaatatatttggtggaagtaattgatttattgaagtagacttaaa 14977

                                                                         
Query: 1161  nnnntgttttgatacaatttctcatgatttaattattaaagaattaaaaagatatatttc 1220
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14978 aaaatgttttgatacaatttctcatgatttaattattaaagaattaaaaagatatatttc 15037

                                                                         
Query: 1221  agataaaggttttattgatttagtatataaattattaagagctggttatattgatgagaa 1280
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15038 agataaaggttttattgatttagtatataaattattaagagctggttatattgatgagaa 15097

                                                                         
Query: 1281  aggaacttatcataaacctatattaggtttacctcaaggatcattaattagtcctatctt 1340
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15098 aggaacttatcataaacctatattaggtttacctcaaggatcattaattagtcctatctt 15157

                                                                         
Query: 1341  atgtaatattgtaataacattggtagataattgattagaagattatattaatttatataa 1400
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15158 atgtaatattgtaataacattggtagataattgattagaagattatattaatttatataa 15217

                                                                         
Query: 1401  taaaggtaaagttaaaaaacaacatcctacatataaaaaattatcaagaataattgcaaa 1460
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15218 taaaggtaaagttaaaaaacaacatcctacatataaaaaattatcaagaataattgcaaa 15277

                                                                         
Query: 1461  agctaaaatattttcgacaagattaaaattacataaagaaagagctaaaggcccactatt 1520
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15278 agctaaaatattttcgacaagattaaaattacataaagaaagagctaaaggcccactatt 15337

                                                                         
Query: 1521  tatttataatgatcctaatttcaagagaataaaatacgttagatatgcagatgatatttt 1580