MedBlast(0.8) Results

Direct References:

Hit Evalue SeqType References
U14913 0.0 N
M80303 0.0 N
X69426 0.0 N
NP_013311 0.0 P  
P24871 0.0 P  
B60048 0.0 P  
CAA49202 0.0 P  
AAA73136 0.0 P  
AAB67425 0.0 P  
NP_010126 1e-108 P  
A60048 1e-108 P  
AAA34765 1e-108 P  
CAA66336 1e-108 P  
CAA98729 1e-108 P  
P24870 1e-107 P  
CAA49201 1e-107 P  
AAC79857 5e-98 P  
CAC28649 6e-78 P  
EAA32372 6e-78 P  
P24865 2e-68 P  
T41518 2e-68 P  
CAB39897 2e-68 P  
AAA35288 2e-67 P  
AAC78639 6e-67 P  
AAC72972 6e-67 P  
A34948 6e-65 P  
NP_595171 6e-65 P  
P10815 6e-65 P  
S01153 6e-65 P  
CAA31070 6e-65 P  
CAA93791 6e-65 P  
CAB46666 6e-65 P  
EAA34615 1e-63 P  
P30284 3e-58 P  
S22694 3e-58 P  
CAA45886 3e-58 P  
NP_593889 4e-55 P  
P36630 4e-55 P  
S44344 4e-55 P  
BAA05943 4e-55 P  
CAC21469 4e-55 P  
A48100 4e-54 P  
CAA49640 4e-54 P  
T52009 1e-53 P  
AAB29297 1e-53 P  
P47829 2e-53 P  
AAC49451 2e-53 P  
JC4828 1e-52 P  
NP_015444 1e-51 P  
P24869 1e-51 P  
S14166 1e-51 P  
CAA44195 1e-51 P  
AAA34502 1e-51 P  
AAB68060 1e-51 P  
NP_011622 2e-51 P  
P24868 2e-51 P  
S14165 2e-51 P  
AAA34501 2e-51 P  
AAA35019 2e-51 P  
CAA97112 2e-51 P  
AAC35952 2e-48 P  
BAA32562 2e-48 P  
NP_004692 3e-48 P  
O95067 3e-48 P  
T12530 3e-48 P  
AAD09309 3e-48 P  
BAA78387 3e-48 P  
CAB45739 3e-48 P  
P13952 6e-48 P  
A30108 6e-48 P  
CAA33513 6e-48 P  
Q08301 1e-47 P  
S34224 1e-47 P  
CAA45876 1e-47 P  
P24862 2e-47 P  
S17793 2e-47 P  
CAA41255 2e-47 P  
AAH08247 2e-47 P  
BAC36200 2e-47 P  
P37882 2e-47 P  
BAA04126 2e-47 P  
CAC24492 3e-47 P  
NP_031656 3e-47 P  
P30276 3e-47 P  
S21529 3e-47 P  
CAA46831 3e-47 P  
BAB28785 4e-47 P  
XP_192758 4e-47 P  
NP_758505 4e-47 P  
P24860 4e-47 P  
A43285 4e-47 P  
AAB22970 4e-47 P  
AAH11478 4e-47 P  
I48316 4e-47 P  
CAA45968 4e-47 P  
P51987 4e-47 P  
CAA62471 4e-47 P  
P07818 5e-47 P  
S00662 5e-47 P  
CAA68650 5e-47 P  
XP_220119 7e-47 P  
NP_776689 7e-47 P  
O77689 7e-47 P  
AAC31953 7e-47 P  
P37883 7e-47 P  
BAA04127 7e-47 P  
AAF82779 7e-47 P  
P13351 7e-47 P  
B32370 7e-47 P  
AAA49697 7e-47 P  
NP_741988 1e-46 P  
P30277 1e-46 P  
S34226 1e-46 P  
CAA43178 1e-46 P  
AAC00032 1e-46 P  
CAA45877 1e-46 P  
Q92162 1e-46 P  
AAB24163 1e-46 P  
AAF82780 2e-46 P  
NP_114172 3e-46 P  
P14635 3e-46 P  
A32992 3e-46 P  
AAH06510 3e-46 P  
NP_571588 4e-46 P  
BAA92876 4e-46 P  
AAH45492 4e-46 P  
Q9DG99 6e-46 P  
BAB17222 6e-46 P  
P29332 6e-46 P  
S23596 6e-46 P  
CAA44392 6e-46 P  
AAH41302 1e-45 P  

References Summary:

  1. Johnston M, Hillier L, Riles L, Albermann K, Andre B, Ansorge W, Benes V, Bruckner M, Delius H, Dubois E, Dusterhoft A, Entian KD, Floeth M, Goffeau A, Hebling U, Heumann K, Heuss-Neitzel D, Hilbert H, Hilger F, Kleine K, Kotter P, Louis EJ, Messenguy F, Mewes HW, Hoheisel JD, et al
    The nucleotide sequence of Saccharomyces cerevisiae chromosome XII.
    Nature 1997 May 29;387(6632 Suppl):87-90
    PMID: 9169871
  2. Olopade OI, Pomykala HM, Hagos F, Sveen LW, Espinosa R 3rd, Dreyling MH, Gursky S, Stadler WM, Le Beau MM, Bohlander SK
    Construction of a 2.8-megabase yeast artificial chromosome contig and cloning of the human methylthioadenosine phosphorylase gene from the tumor suppressor region on 9p21.
    Proc Natl Acad Sci U S A 1995 Jul 3;92(14):6489-93
    PMID: 7604019
  3. Spang A, Geissler S, Grein K, Schiebel E
    gamma-Tubulin-like Tub4p of Saccharomyces cerevisiae is associated with the spindle pole body substructures that organize microtubules and is required for mitotic spindle formation.
    J Cell Biol 1996 Jul;134(2):429-41
    PMID: 8707827
  4. Burns RG
    Identification of two new members of the tubulin family.
    Cell Motil Cytoskeleton 1995;31(4):255-8
    PMID: 7553912
  5. Fitch I, Dahmann C, Surana U, Amon A, Nasmyth K, Goetsch L, Byers B, Futcher B
    Characterization of four B-type cyclin genes of the budding yeast Saccharomyces cerevisiae.
    Mol Biol Cell 1992 Jul;3(7):805-18
    PMID: 1387566
  6. Muhlrad D, Parker R
    Mutations affecting stability and deadenylation of the yeast MFA2 transcript.
    Genes Dev 1992 Nov;6(11):2100-11
    PMID: 1427074
  7. Lowell JE, Rudner DZ, Sachs AB
    3'-UTR-dependent deadenylation by the yeast poly(A) nuclease.
    Genes Dev 1992 Nov;6(11):2088-99
    PMID: 1358757
  8. Frank D, Guthrie C
    An essential splicing factor, SLU7, mediates 3' splice site choice in yeast.
    Genes Dev 1992 Nov;6(11):2112-24
    PMID: 1427075
  9. Richardson H, Lew DJ, Henze M, Sugimoto K, Reed SI
    Cyclin-B homologs in Saccharomyces cerevisiae function in S phase and in G2.
    Genes Dev 1992 Nov;6(11):2021-34
    PMID: 1427070

 

Indirect References:

Hit Evalue SeqType References
U14913 0.0 N
M80303 0.0 N  
X69426 0.0 N
  • clb4p (...)
  • clb4 (...)
NP_013311 0.0 P
  • clb4p (...)
  • clb4 (...)
P24871 0.0 P  
B60048 0.0 P  
CAA49202 0.0 P
  • clb4p (...)
  • clb4 (...)
AAA73136 0.0 P  
AAB67425 0.0 P
  • clb4p (...)
  • clb4 (...)
NP_010126 1e-108 P
A60048 1e-108 P  
AAA34765 1e-108 P  
CAA66336 1e-108 P
  • clb3p (...)
  • clb3 (...)
CAA98729 1e-108 P
  • clb3p (...)
  • clb3 (...)
P24870 1e-107 P  
CAA49201 1e-107 P
  • clb3p (...)
  • clb3 (...)
AAC79857 5e-98 P
  • cyb2 (-)
CAC28649 6e-78 P  
EAA32372 6e-78 P  
P24865 2e-68 P  
T41518 2e-68 P  
CAB39897 2e-68 P  
AAA35288 2e-67 P  
AAC78639 6e-67 P
AAC72972 6e-67 P
  • cdc13 (...)
A34948 6e-65 P  
NP_595171 6e-65 P
  • cdc13 (...)
P10815 6e-65 P  
S01153 6e-65 P  
CAA31070 6e-65 P  
CAA93791 6e-65 P
  • cdc13 (...)
CAB46666 6e-65 P  
EAA34615 1e-63 P  
P30284 3e-58 P  
S22694 3e-58 P  
CAA45886 3e-58 P
NP_593889 4e-55 P
P36630 4e-55 P  
S44344 4e-55 P  
BAA05943 4e-55 P  
CAC21469 4e-55 P  
A48100 4e-54 P  
CAA49640 4e-54 P  
T52009 1e-53 P  
AAB29297 1e-53 P
  • cig2 (...)
P47829 2e-53 P  
AAC49451 2e-53 P
JC4828 1e-52 P  
NP_015444 1e-51 P
P24869 1e-51 P  
S14166 1e-51 P  
CAA44195 1e-51 P
  • clb2 (...)
  • clb2p (...)
AAA34502 1e-51 P
  • clb2 (...)
  • clb2p (...)
AAB68060 1e-51 P
  • clb2 (...)
  • clb2p (...)
NP_011622 2e-51 P
P24868 2e-51 P  
S14165 2e-51 P  
AAA34501 2e-51 P
  • clb1 (...)
  • scb1p (-)
  • clb1p (-)
  • scb1 (...)
AAA35019 2e-51 P
  • clb1 (...)
  • scb1p (-)
  • clb1p (-)
  • scb1 (...)
CAA97112 2e-51 P
  • clb1 (...)
  • scb1p (-)
  • clb1p (-)
  • scb1 (...)
AAC35952 2e-48 P  
BAA32562 2e-48 P  
NP_004692 3e-48 P
  • ccnb2 (-)
O95067 3e-48 P  
T12530 3e-48 P  
AAD09309 3e-48 P  
BAA78387 3e-48 P
CAB45739 3e-48 P
  • dkfzp434b174 (-)
P13952 6e-48 P  
A30108 6e-48 P  
CAA33513 6e-48 P  
Q08301 1e-47 P  
S34224 1e-47 P  
CAA45876 1e-47 P  
P24862 2e-47 P  
S17793 2e-47 P  
CAA41255 2e-47 P  
AAH08247 2e-47 P  
BAC36200 2e-47 P  
P37882 2e-47 P  
BAA04126 2e-47 P  
CAC24492 3e-47 P  
NP_031656 3e-47 P
  • ccnb2 (-)
P30276 3e-47 P  
S21529 3e-47 P  
CAA46831 3e-47 P
  • cycb2 (...)
BAB28785 4e-47 P  
XP_192758 4e-47 P
  • loc268697 (-)
NP_758505 4e-47 P
P24860 4e-47 P  
A43285 4e-47 P  
AAB22970 4e-47 P
AAH11478 4e-47 P  
I48316 4e-47 P  
CAA45968 4e-47 P
P51987 4e-47 P  
CAA62471 4e-47 P
P07818 5e-47 P  
S00662 5e-47 P  
CAA68650 5e-47 P  
XP_220119 7e-47 P
  • loc309558 (-)
NP_776689 7e-47 P
  • ccnb2 (-)
O77689 7e-47 P  
AAC31953 7e-47 P
  • cycb2 (...)
P37883 7e-47 P  
BAA04127 7e-47 P  
AAF82779 7e-47 P  
P13351 7e-47 P  
B32370 7e-47 P  
AAA49697 7e-47 P  
NP_741988 1e-46 P
  • ccnb1 (...)
P30277 1e-46 P  
S34226 1e-46 P  
CAA43178 1e-46 P  
AAC00032 1e-46 P  
CAA45877 1e-46 P  
Q92162 1e-46 P  
AAB24163 1e-46 P
  • cyclin (...)
AAF82780 2e-46 P  
NP_114172 3e-46 P
  • ccnb1 (...)
  • ccnb (-)
P14635 3e-46 P  
A32992 3e-46 P  
AAH06510 3e-46 P  
NP_571588 4e-46 P
  • ccnb1 (...)
BAA92876 4e-46 P  
AAH45492 4e-46 P  
Q9DG99 6e-46 P  
BAB17222 6e-46 P  
P29332 6e-46 P  
S23596 6e-46 P  
CAA44392 6e-46 P
  • cycb2 (...)
AAH41302 1e-45 P  

References Summary:

  1. Segal M, Clarke DJ, Maddox P, Salmon ED, Bloom K, Reed SI
    Coordinated spindle assembly and orientation requires Clb5p-dependent kinase in budding yeast.
    J Cell Biol 2000 Feb 7;148(3):441-52
    PMID: 10662771
  2. Dahmann C, Futcher B
    Specialization of B-type cyclins for mitosis or meiosis in S. cerevisiae.
    Genetics 1995 Jul;140(3):957-63
    PMID: 7672594
  3. Schwob E, Nasmyth K
    CLB5 and CLB6, a new pair of B cyclins involved in DNA replication in Saccharomyces cerevisiae.
    Genes Dev 1993 Jul;7(7A):1160-75
    PMID: 8319908
  4. Amon A, Irniger S, Nasmyth K
    Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle.
    Cell 1994 Jul 1;77(7):1037-50
    PMID: 8020094
  5. Hepworth SR, Friesen H, Segall J
    NDT80 and the meiotic recombination checkpoint regulate expression of middle sporulation-specific genes in Saccharomyces cerevisiae.
    Mol Cell Biol 1998 Oct;18(10):5750-61
    PMID: 9742092
  6. Segal M, Clarke DJ, Reed SI
    Clb5-associated kinase activity is required early in the spindle pathway for correct preanaphase nuclear positioning in Saccharomyces cerevisiae.
    J Cell Biol 1998 Oct 5;143(1):135-45
    PMID: 9763426
  7. Stuart D, Wittenberg C
    CLB5 and CLB6 are required for premeiotic DNA replication and activation of the meiotic S/M checkpoint.
    Genes Dev 1998 Sep 1;12(17):2698-710
    PMID: 9732268
  8. Bai C, Richman R, Elledge SJ
    Human cyclin F.
    EMBO J 1994 Dec 15;13(24):6087-98
    PMID: 7813445
  9. Surana U, Robitsch H, Price C, Schuster T, Fitch I, Futcher AB, Nasmyth K
    The role of CDC28 and cyclins during mitosis in the budding yeast S. cerevisiae.
    Cell 1991 Apr 5;65(1):145-61
    PMID: 1849457
  10. Blondel M, Mann C
    G2 cyclins are required for the degradation of G1 cyclins in yeast.
    Nature 1996 Nov 21;384(6606):279-82
    PMID: 8918881
  11. Grandin N, Reed SI
    Differential function and expression of Saccharomyces cerevisiae B-type cyclins in mitosis and meiosis.
    Mol Cell Biol 1993 Apr;13(4):2113-25
    PMID: 8455600
  12. Koch C, Schleiffer A, Ammerer G, Nasmyth K
    Switching transcription on and off during the yeast cell cycle: Cln/Cdc28 kinases activate bound transcription factor SBF (Swi4/Swi6) at start, whereas Clb/Cdc28 kinases displace it from the promoter in G2.
    Genes Dev 1996 Jan 15;10(2):129-41
    PMID: 8566747
  13. Irniger S, Nasmyth K
    The anaphase-promoting complex is required in G1 arrested yeast cells to inhibit B-type cyclin accumulation and to prevent uncontrolled entry into S-phase.
    J Cell Sci 1997 Jul;110 ( Pt 13):1523-31
    PMID: 9224769
  14. Shellman YG, Svee E, Sclafani RA, Langan TA
    Identification and characterization of individual cyclin-dependent kinase complexes from Saccharomyces cerevisiae.
    Yeast 1999 Mar 15;15(4):295-309
    PMID: 10206189
  15. Kuntzel H, Schulz A, Ehbrecht IM
    Cell cycle control and initiation of DNA replication in Saccharomyces cerevisiae.
    Biol Chem 1996 Jul-Aug;377(7-8):481-7
    PMID: 8922282
  16. Delaveau T, Blugeon C, Jacq C, Perea J
    Analysis of a 23 kb region on the left arm of yeast chromosome IV.
    Yeast 1996 Dec;12(15):1587-92
    PMID: 8972581
  17. Ghislain M, Udvardy A, Mann C
    S. cerevisiae 26S protease mutants arrest cell division in G2/metaphase.
    Nature 1993 Nov 25;366(6453):358-62
    PMID: 8247132
  18. Li X, Cai M
    Inactivation of the cyclin-dependent kinase Cdc28 abrogates cell cycle arrest induced by DNA damage and disassembly of mitotic spindles in Saccharomyces cerevisiae.
    Mol Cell Biol 1997 May;17(5):2723-34
    PMID: 9111343
  19. Baumer M, Braus GH, Irniger S
    Two different modes of cyclin clb2 proteolysis during mitosis in Saccharomyces cerevisiae.
    FEBS Lett 2000 Feb 25;468(2-3):142-8
    PMID: 10692575
  20. Sikder H, Funakoshi M, Nishimoto T, Kobayashi H
    An altered nuclear migration into the daughter bud is induced by the cyclin A1-mediated Cdc28 kinase through an aberrant spindle movement in Saccharomyces cerevisiae.
    Cell Struct Funct 1997 Aug;22(4):465-76
    PMID: 9368720
  21. Kellogg DR, Kikuchi A, Fujii-Nakata T, Turck CW, Murray AW
    Members of the NAP/SET family of proteins interact specifically with B-type cyclins.
    J Cell Biol 1995 Aug;130(3):661-73
    PMID: 7622566
  22. Funakoshi M, Kajiwara R, Goda T, Nishimoto T, Kobayashi H
    Isolation and characterisation of a mutation in the PMR1 gene encoding a Golgi membrane ATPase, which causes hypersensitivity to over-expression of Clb3 in Saccharomyces cerevisiae.
    Mol Gen Genet 2000 Sep;264(1-2):29-36
    PMID: 11016830
  23. Schwab M, Neutzner M, Mocker D, Seufert W
    Yeast Hct1 recognizes the mitotic cyclin Clb2 and other substrates of the ubiquitin ligase APC.
    EMBO J 2001 Sep 17;20(18):5165-75
    PMID: 11566880
  24. Kottom TJ, Thomas CF Jr, Mubarak KK, Leof EB, Limper AH
    Pneumocystis carinii uses a functional cdc13 B-type cyclin complex during its life cycle.
    Am J Respir Cell Mol Biol 2000 Jun;22(6):722-31
    PMID: 10837370
  25. Ye XS, Lee SL, Wolkow TD, McGuire SL, Hamer JE, Wood GC, Osmani SA
    Interaction between developmental and cell cycle regulators is required for morphogenesis in Aspergillus nidulans.
    EMBO J 1999 Dec 15;18(24):6994-7001
    PMID: 10601021
  26. Wu L, Osmani SA, Mirabito PM
    A role for NIMA in the nuclear localization of cyclin B in Aspergillus nidulans.
    J Cell Biol 1998 Jun 29;141(7):1575-87
    PMID: 9647650
  27. Schier N, Fischer R
    The Aspergillus nidulans cyclin PclA accumulates in the nucleus and interacts with the central cell cycle regulator NimX(Cdc2).
    FEBS Lett 2002 Jul 17;523(1-3):143-6
    PMID: 12123821
  28. McGuire SL, Roe DL, Carter BW, Carter RL, Grace SP, Hays PL, Lang GA, Mamaril JL, McElvaine AT, Payne AM, Schrader MD, Wahrle SE, Young CD
    Extragenic suppressors of the nimX2(cdc2) mutation of Aspergillus nidulans affect nuclear division, septation and conidiation.
    Genetics 2000 Dec;156(4):1573-84
    PMID: 11102358
  29. O'Connell MJ, Osmani AH, Morris NR, Osmani SA
    An extra copy of nimEcyclinB elevates pre-MPF levels and partially suppresses mutation of nimTcdc25 in Aspergillus nidulans.
    EMBO J 1992 Jun;11(6):2139-49
    PMID: 1534750
  30. Ye XS, Fincher RR, Tang A, Osmani AH, Osmani SA
    Regulation of the anaphase-promoting complex/cyclosome by bimAAPC3 and proteolysis of NIMA.
    Mol Biol Cell 1998 Nov;9(11):3019-30
    PMID: 9802893
  31. Martin-Castellanos C, Moreno S
    Regulation of G1 progression in fission yeast by the rum1+ gene product.
    Prog Cell Cycle Res 1996;2:29-35
    PMID: 9552380
  32. Noguchi E, Shanahan P, Noguchi C, Russell P
    CDK phosphorylation of Drc1 regulates DNA replication in fission yeast.
    Curr Biol 2002 Apr 2;12(7):599-605
    PMID: 11937031
  33. Martin-Castellanos C, Blanco MA, de Prada JM, Moreno S
    The puc1 cyclin regulates the G1 phase of the fission yeast cell cycle in response to cell size.
    Mol Biol Cell 2000 Feb;11(2):543-54
    PMID: 10679013
  34. Blanco MA, Sanchez-Diaz A, de Prada JM, Moreno S
    APC(ste9/srw1) promotes degradation of mitotic cyclins in G(1) and is inhibited by cdc2 phosphorylation.
    EMBO J 2000 Aug 1;19(15):3945-55
    PMID: 10921876
  35. Martin-Castellanos C, Labib K, Moreno S
    B-type cyclins regulate G1 progression in fission yeast in opposition to the p25rum1 cdk inhibitor.
    EMBO J 1996 Feb 15;15(4):839-49
    PMID: 8631305
  36. Fisher DL, Nurse P
    A single fission yeast mitotic cyclin B p34cdc2 kinase promotes both S-phase and mitosis in the absence of G1 cyclins.
    EMBO J 1996 Feb 15;15(4):850-60
    PMID: 8631306
  37. Mondesert O, McGowan CH, Russell P
    Cig2, a B-type cyclin, promotes the onset of S in Schizosaccharomyces pombe.
    Mol Cell Biol 1996 Apr;16(4):1527-33
    PMID: 8657126
  38. Lee KM, Saiz JE, Barton WA, Fisher RP
    Cdc2 activation in fission yeast depends on Mcs6 and Csk1, two partially redundant Cdk-activating kinases (CAKs).
    Curr Biol 1999 Apr 22;9(8):441-4
    PMID: 10226032
  39. Borgne A, Murakami H, Ayte J, Nurse P
    The G1/S cyclin Cig2p during meiosis in fission yeast.
    Mol Biol Cell 2002 Jun;13(6):2080-90
    PMID: 12058071
  40. Grallert B, Kearsey SE, Lenhard M, Carlson CR, Nurse P, Boye E, Labib K
    A fission yeast general translation factor reveals links between protein synthesis and cell cycle controls.
    J Cell Sci 2000 Apr;113 ( Pt 8):1447-58
    PMID: 10725227
  41. Snaith HA, Forsburg SL
    Rereplication phenomenon in fission yeast requires MCM proteins and other S phase genes.
    Genetics 1999 Jul;152(3):839-51
    PMID: 10388806
  42. Sanchez M, Calzada A, Bueno A
    Functionally homologous DNA replication genes in fission and budding yeast.
    J Cell Sci 1999 Jul;112 ( Pt 14):2381-90
    PMID: 10381393
  43. Yamaguchi S, Murakami H, Okayama H
    A WD repeat protein controls the cell cycle and differentiation by negatively regulating Cdc2/B-type cyclin complexes.
    Mol Biol Cell 1997 Dec;8(12):2475-86
    PMID: 9398669
  44. Ayte J, Schweitzer C, Zarzov P, Nurse P, DeCaprio JA
    Feedback regulation of the MBF transcription factor by cyclin Cig2.
    Nat Cell Biol 2001 Dec;3(12):1043-50
    PMID: 11781565
  45. Fisher D, Nurse P
    Cyclins of the fission yeast Schizosaccharomyces pombe.
    Semin Cell Biol 1995 Apr;6(2):73-8
    PMID: 7548845
  46. Wuarin J, Buck V, Nurse P, Millar JB
    Stable association of mitotic cyclin B/Cdc2 to replication origins prevents endoreduplication.
    Cell 2002 Nov 1;111(3):419-31
    PMID: 12419251
  47. Yamano H, Kitamura K, Kominami K, Lehmann A, Katayama S, Hunt T, Toda T
    The spike of S phase cyclin Cig2 expression at the G1-S border in fission yeast requires both APC and SCF ubiquitin ligases.
    Mol Cell 2000 Dec;6(6):1377-87
    PMID: 11163211
  48. Baum B, Wuarin J, Nurse P
    Control of S-phase periodic transcription in the fission yeast mitotic cycle.
    EMBO J 1997 Aug 1;16(15):4676-88
    PMID: 9303312
  49. Kominami K, Seth-Smith H, Toda T
    Apc10 and Ste9/Srw1, two regulators of the APC-cyclosome, as well as the CDK inhibitor Rum1 are required for G1 cell-cycle arrest in fission yeast.
    EMBO J 1998 Sep 15;17(18):5388-99
    PMID: 9736616
  50. Jallepalli PV, Brown GW, Muzi-Falconi M, Tien D, Kelly TJ
    Regulation of the replication initiator protein p65cdc18 by CDK phosphorylation.
    Genes Dev 1997 Nov 1;11(21):2767-79
    PMID: 9353247
  51. Wu L, Russell P
    Roles of Wee1 and Nim1 protein kinases in regulating the switch from mitotic division to sexual development in Schizosaccharomyces pombe.
    Mol Cell Biol 1997 Jan;17(1):10-7
    PMID: 8972180
  52. Lopez-Girona A, Mondesert O, Leatherwood J, Russell P
    Negative regulation of Cdc18 DNA replication protein by Cdc2.
    Mol Biol Cell 1998 Jan;9(1):63-73
    PMID: 9436991
  53. Stern B, Nurse P
    Cyclin B proteolysis and the cyclin-dependent kinase inhibitor rum1p are required for pheromone-induced G1 arrest in fission yeast.
    Mol Biol Cell 1998 Jun;9(6):1309-21
    PMID: 9614176
  54. Connolly T, Beach D
    Interaction between the Cig1 and Cig2 B-type cyclins in the fission yeast cell cycle.
    Mol Cell Biol 1994 Jan;14(1):768-76
    PMID: 8264644
  55. Bueno A, Russell P
    Two fission yeast B-type cyclins, cig2 and Cdc13, have different functions in mitosis.
    Mol Cell Biol 1993 Apr;13(4):2286-97
    PMID: 8455610
  56. Kitamura K, Maekawa H, Shimoda C
    Fission yeast Ste9, a homolog of Hct1/Cdh1 and Fizzy-related, is a novel negative regulator of cell cycle progression during G1-phase.
    Mol Biol Cell 1998 May;9(5):1065-80
    PMID: 9571240
  57. Zarzov P, Decottignies A, Baldacci G, Nurse P
    G(1)/S CDK is inhibited to restrain mitotic onset when DNA replication is blocked in fission yeast.
    EMBO J 2002 Jul 1;21(13):3370-6
    PMID: 12093738
  58. Damagnez V, Cottarel G
    Candida albicans CDK1 and CYB1: cDNA homologues of the cdc2/CDC28 and cdc13/CLB1/CLB2 cell cycle control genes.
    Gene 1996 Jun 12;172(1):137-41
    PMID: 8654974
  59. Zhu G, Spellman PT, Volpe T, Brown PO, Botstein D, Davis TN, Futcher B
    Two yeast forkhead genes regulate the cell cycle and pseudohyphal growth.
    Nature 2000 Jul 6;406(6791):90-4
    PMID: 10894548
  60. Yeong FM, Lim HH, Padmashree CG, Surana U
    Exit from mitosis in budding yeast: biphasic inactivation of the Cdc28-Clb2 mitotic kinase and the role of Cdc20.
    Mol Cell 2000 Mar;5(3):501-11
    PMID: 10882135
  61. Koranda M, Schleiffer A, Endler L, Ammerer G
    Forkhead-like transcription factors recruit Ndd1 to the chromatin of G2/M-specific promoters.
    Nature 2000 Jul 6;406(6791):94-8
    PMID: 10894549
  62. Sheu YJ, Barral Y, Snyder M
    Polarized growth controls cell shape and bipolar bud site selection in Saccharomyces cerevisiae.
    Mol Cell Biol 2000 Jul;20(14):5235-47
    PMID: 10866679
  63. Song S, Lee KS
    A novel function of Saccharomyces cerevisiae CDC5 in cytokinesis.
    J Cell Biol 2001 Feb 5;152(3):451-69
    PMID: 11157974
  64. Pic A, Lim FL, Ross SJ, Veal EA, Johnson AL, Sultan MR, West AG, Johnston LH, Sharrocks AD, Morgan BA
    The forkhead protein Fkh2 is a component of the yeast cell cycle transcription factor SFF.
    EMBO J 2000 Jul 17;19(14):3750-61
    PMID: 10899128
  65. Ro HS, Song S, Lee KS
    Bfa1 can regulate Tem1 function independently of Bub2 in the mitotic exit network of Saccharomyces cerevisiae.
    Proc Natl Acad Sci U S A 2002 Apr 16;99(8):5436-41
    PMID: 11959999
  66. Honey S, Schneider BL, Schieltz DM, Yates JR, Futcher B
    A novel multiple affinity purification tag and its use in identification of proteins associated with a cyclin-CDK complex.
    Nucleic Acids Res 2001 Feb 15;29(4):E24
    PMID: 11160944
  67. Rua D, Tobe BT, Kron SJ
    Cell cycle control of yeast filamentous growth.
    Curr Opin Microbiol 2001 Dec;4(6):720-7
    PMID: 11731325
  68. Mouassite M, Camougrand N, Schwob E, Demaison G, Laclau M, Guerin M
    The 'SUN' family: yeast SUN4/SCW3 is involved in cell septation.
    Yeast 2000 Jul;16(10):905-19
    PMID: 10870102
  69. Futcher B
    Microarrays and cell cycle transcription in yeast.
    Curr Opin Cell Biol 2000 Dec;12(6):710-5
    PMID: 11063936
  70. Lee SE, Frenz LM, Wells NJ, Johnson AL, Johnston LH
    Order of function of the budding-yeast mitotic exit-network proteins Tem1, Cdc15, Mob1, Dbf2, and Cdc5.
    Curr Biol 2001 May 15;11(10):784-8
    PMID: 11378390
  71. Mateus C, Avery SV
    Destabilized green fluorescent protein for monitoring dynamic changes in yeast gene expression with flow cytometry.
    Yeast 2000 Oct;16(14):1313-23
    PMID: 11015728
  72. Sclafani RA, Tecklenburg M, Pierce A
    The mcm5-bob1 bypass of Cdc7p/Dbf4p in DNA replication depends on both Cdk1-independent and Cdk1-dependent steps in Saccharomyces cerevisiae.
    Genetics 2002 May;161(1):47-57
    PMID: 12019222
  73. Nguyen VQ, Co C, Irie K, Li JJ
    Clb/Cdc28 kinases promote nuclear export of the replication initiator proteins Mcm2-7.
    Curr Biol 2000 Feb 24;10(4):195-205
    PMID: 10704410
  74. Bolte M, Steigemann P, Braus GH, Irniger S
    Inhibition of APC-mediated proteolysis by the meiosis-specific protein kinase Ime2.
    Proc Natl Acad Sci U S A 2002 Apr 2;99(7):4385-90
    PMID: 11917129
  75. Shah R, Jensen S, Frenz LM, Johnson AL, Johnston LH
    The Spo12 protein of Saccharomyces cerevisiae: a regulator of mitotic exit whose cell cycle-dependent degradation is mediated by the anaphase-promoting complex.
    Genetics 2001 Nov;159(3):965-80
    PMID: 11729145
  76. Grate D, Wilson C
    Inducible regulation of the S. cerevisiae cell cycle mediated by an RNA aptamer-ligand complex.
    Bioorg Med Chem 2001 Oct;9(10):2565-70
    PMID: 11557344
  77. Padmashree CG, Surana U
    Cdc28-Clb mitotic kinase negatively regulates bud site assembly in the budding yeast.
    J Cell Sci 2001 Jan;114(Pt 1):207-218
    PMID: 11112704
  78. Goh PY, Lim HH, Surana U
    Cdc20 protein contains a destruction-box but, unlike Clb2, its proteolysisis not acutely dependent on the activity of anaphase-promoting complex.
    Eur J Biochem 2000 Jan;267(2):434-49
    PMID: 10632713
  79. Calzada A, Sacristan M, Sanchez E, Bueno A
    Cdc6 cooperates with Sic1 and Hct1 to inactivate mitotic cyclin-dependent kinases.
    Nature 2001 Jul 19;412(6844):355-8
    PMID: 11460169
  80. Ross KE, Kaldis P, Solomon MJ
    Activating phosphorylation of the Saccharomyces cerevisiae cyclin-dependent kinase, cdc28p, precedes cyclin binding.
    Mol Biol Cell 2000 May;11(5):1597-609
    PMID: 10793138
  81. Kumar R, Reynolds DM, Shevchenko A, Shevchenko A, Goldstone SD, Dalton S
    Forkhead transcription factors, Fkh1p and Fkh2p, collaborate with Mcm1p to control transcription required for M-phase.
    Curr Biol 2000 Jul 27-Aug 10;10(15):896-906
    PMID: 10959837
  82. Shou W, Deshaies RJ
    Multiple telophase arrest bypassed (tab) mutants alleviate the essential requirement for Cdc15 in exit from mitosis in S. cerevisiae.
    BMC Genet 2002 Mar 12;3(1):4
    PMID: 11914130
  83. Irniger S
    Cyclin destruction in mitosis: a crucial task of Cdc20.
    FEBS Lett 2002 Dec 4;532(1-2):7-11
    PMID: 12459453
  84. Chen KC, Csikasz-Nagy A, Gyorffy B, Val J, Novak B, Tyson JJ
    Kinetic analysis of a molecular model of the budding yeast cell cycle.
    Mol Biol Cell 2000 Jan;11(1):369-91
    PMID: 10637314
  85. Donaldson AD
    The yeast mitotic cyclin Clb2 cannot substitute for S phase cyclins in replication origin firing.
    EMBO Rep 2000 Dec;1(6):507-12
    PMID: 11263495
  86. Jona G, Livi LL, Gileadi O
    Mutations in the RING domain of TFB3, a subunit of yeast transcription factor IIH, reveal a role in cell cycle progression.
    J Biol Chem 2002 Oct 18;277(42):39409-16
    PMID: 12176978
  87. Miled C, Mann C, Faye G
    Xbp1-mediated repression of CLB gene expression contributes to the modifications of yeast cell morphology and cell cycle seen during nitrogen-limited growth.
    Mol Cell Biol 2001 Jun;21(11):3714-24
    PMID: 11340165
  88. Cai T, Aulds J, Gill T, Cerio M, Schmitt ME
    The Saccharomyces cerevisiae RNase mitochondrial RNA processing is critical for cell cycle progression at the end of mitosis.
    Genetics 2002 Jul;161(3):1029-42
    PMID: 12136008
  89. Hendrickson C, Meyn MA 3rd, Morabito L, Holloway SL
    The KEN box regulates Clb2 proteolysis in G1 and at the metaphase-to-anaphase transition.
    Curr Biol 2001 Nov 13;11(22):1781-7
    PMID: 11719221
  90. Hollenhorst PC, Bose ME, Mielke MR, Muller U, Fox CA
    Forkhead genes in transcriptional silencing, cell morphology and the cell cycle. Overlapping and distinct functions for FKH1 and FKH2 in Saccharomyces cerevisiae.
    Genetics 2000 Apr;154(4):1533-48
    PMID: 10747051
  91. Yuste-Rojas M, Cross FR
    Mutations in CDC14 result in high sensitivity to cyclin gene dosage in Saccharomyces cerevisiae.
    Mol Gen Genet 2000 Feb;263(1):60-72
    PMID: 10732674
  92. Morgan DO, Roberts JM
    Oscillation sensation.
    Nature 2002 Aug 1;418(6897):495-6
    PMID: 12152065
  93. Hood JK, Hwang WW, Silver PA
    The Saccharomyces cerevisiae cyclin Clb2p is targeted to multiple subcellular locations by cis- and trans-acting determinants.
    J Cell Sci 2001 Feb;114(Pt 3):589-97
    PMID: 11171327
  94. Wasch R, Cross FR
    APC-dependent proteolysis of the mitotic cyclin Clb2 is essential for mitotic exit.
    Nature 2002 Aug 1;418(6897):556-62
    PMID: 12152084
  95. Ahn SH, Tobe BT, Fitz Gerald JN, Anderson SL, Acurio A, Kron SJ
    Enhanced cell polarity in mutants of the budding yeast cyclin-dependent kinase Cdc28p.
    Mol Biol Cell 2001 Nov;12(11):3589-600
    PMID: 11694591
  96. Wu C, Leeuw T, Leberer E, Thomas DY, Whiteway M
    Cell cycle- and Cln2p-Cdc28p-dependent phosphorylation of the yeast Ste20p protein kinase.
    J Biol Chem 1998 Oct 23;273(43):28107-15
    PMID: 9774429
  97. Xu S, Huang HK, Kaiser P, Latterich M, Hunter T
    Phosphorylation and spindle pole body localization of the Cdc15p mitotic regulatory protein kinase in budding yeast.
    Curr Biol 2000 Mar 23;10(6):329-32
    PMID: 10744974
  98. Jaquenoud M, van Drogen F, Peter M
    Cell cycle-dependent nuclear export of Cdh1p may contribute to the inactivation of APC/C(Cdh1).
    EMBO J 2002 Dec 2;21(23):6515-26
    PMID: 12456658
  99. Shimizu Y, Akashi T, Okuda A, Kikuchi A, Fukui K
    NBP1 (Nap1 binding protein 1), an essential gene for G2/M transition of Saccharomyces cerevisiae, encodes a protein of distinct sub-nuclear localization.
    Gene 2000 Apr 4;246(1-2):395-404
    PMID: 10767562
  100. Shu Y, Yang H, Hallberg E, Hallberg R
    Molecular genetic analysis of Rts1p, a B' regulatory subunit of Saccharomyces cerevisiae protein phosphatase 2A.
    Mol Cell Biol 1997 Jun;17(6):3242-53
    PMID: 9154823
  101. Townsley FM, Ruderman JV
    Functional analysis of the Saccharomyces cerevisiae UBC11 gene.
    Yeast 1998 Jun 15;14(8):747-57
    PMID: 9675819
  102. Santamaria PG, Finley D, Ballesta JP, Remacha M
    Rpn6p, a Proteasome Subunit from Saccharomyces cerevisiae, Is Essential for the Assembly and Activity of the 26 S Proteasome.
    J Biol Chem 2003 Feb 28;278(9):6687-95
    PMID: 12486135
  103. Hwang HS, Song K
    IBD2 encodes a novel component of the Bub2p-dependent spindle checkpoint in the budding yeast Saccharomyces cerevisiae.
    Genetics 2002 Jun;161(2):595-609
    PMID: 12072457
  104. Farr KA, Hoyt MA
    Bub1p kinase activates the Saccharomyces cerevisiae spindle assembly checkpoint.
    Mol Cell Biol 1998 May;18(5):2738-47
    PMID: 9566893
  105. Cross FR, Yuste-Rojas M, Gray S, Jacobson MD
    Specialization and targeting of B-type cyclins.
    Mol Cell 1999 Jul;4(1):11-9
    PMID: 10445023
  106. Takeuchi J, Toh-e A
    Genetic dissection of the yeast 26S proteasome: cell cycle defects caused by the Deltarpn9 mutation.
    Biochimie 2001 Mar-Apr;83(3-4):333-40
    PMID: 11295494
  107. Kramer KM, Fesquet D, Johnson AL, Johnston LH
    Budding yeast RSI1/APC2, a novel gene necessary for initiation of anaphase, encodes an APC subunit.
    EMBO J 1998 Jan 15;17(2):498-506
    PMID: 9430641
  108. Longtine MS, Theesfeld CL, McMillan JN, Weaver E, Pringle JR, Lew DJ
    Septin-dependent assembly of a cell cycle-regulatory module in Saccharomyces cerevisiae.
    Mol Cell Biol 2000 Jun;20(11):4049-61
    PMID: 10805747
  109. Leverson JD, Joazeiro CA, Page AM, Huang H, Hieter P, Hunter T
    The APC11 RING-H2 finger mediates E2-dependent ubiquitination.
    Mol Biol Cell 2000 Jul;11(7):2315-25
    PMID: 10888670
  110. Friedman H, Snyder M
    Mutations in PRG1, a yeast proteasome-related gene, cause defects in nuclear division and are suppressed by deletion of a mitotic cyclin gene.
    Proc Natl Acad Sci U S A 1994 Mar 15;91(6):2031-5
    PMID: 8134345
  111. Shirayama M, Zachariae W, Ciosk R, Nasmyth K
    The Polo-like kinase Cdc5p and the WD-repeat protein Cdc20p/fizzy are regulators and substrates of the anaphase promoting complex in Saccharomyces cerevisiae.
    EMBO J 1998 Mar 2;17(5):1336-49
    PMID: 9482731
  112. Spellman PT, Sherlock G, Zhang MQ, Iyer VR, Anders K, Eisen MB, Brown PO, Botstein D, Futcher B
    Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization.
    Mol Biol Cell 1998 Dec;9(12):3273-97
    PMID: 9843569
  113. Nasmyth K
    Control of the yeast cell cycle by the Cdc28 protein kinase.
    Curr Opin Cell Biol 1993 Apr;5(2):166-79
    PMID: 8507488
  114. Schwob E, Bohm T, Mendenhall MD, Nasmyth K
    The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae.
    Cell 1994 Oct 21;79(2):233-44
    PMID: 7954792
  115. Lew DJ, Reed SI
    Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins.
    J Cell Biol 1993 Mar;120(6):1305-20
    PMID: 8449978
  116. Lew DJ, Reed SI
    A cell cycle checkpoint monitors cell morphogenesis in budding yeast.
    J Cell Biol 1995 May;129(3):739-49
    PMID: 7730408
  117. Ahn SH, Acurio A, Kron SJ
    Regulation of G2/M progression by the STE mitogen-activated protein kinase pathway in budding yeast filamentous growth.
    Mol Biol Cell 1999 Oct;10(10):3301-16
    PMID: 10512868
  118. Althoefer H, Schleiffer A, Wassmann K, Nordheim A, Ammerer G
    Mcm1 is required to coordinate G2-specific transcription in Saccharomyces cerevisiae.
    Mol Cell Biol 1995 Nov;15(11):5917-28
    PMID: 7565744
  119. Piatti S, Bohm T, Cocker JH, Diffley JF, Nasmyth K
    Activation of S-phase-promoting CDKs in late G1 defines a "point of no return" after which Cdc6 synthesis cannot promote DNA replication in yeast.
    Genes Dev 1996 Jun 15;10(12):1516-31
    PMID: 8666235
  120. Amon A, Tyers M, Futcher B, Nasmyth K
    Mechanisms that help the yeast cell cycle clock tick: G2 cyclins transcriptionally activate G2 cyclins and repress G1 cyclins.
    Cell 1993 Sep 24;74(6):993-1007
    PMID: 8402888
  121. Chu S, Herskowitz I
    Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80.
    Mol Cell 1998 Apr;1(5):685-96
    PMID: 9660952
  122. Kellogg DR, Murray AW
    NAP1 acts with Clb1 to perform mitotic functions and to suppress polar bud growth in budding yeast.
    J Cell Biol 1995 Aug;130(3):675-85
    PMID: 7622567
  123. Schneider BL, Patton EE, Lanker S, Mendenhall MD, Wittenberg C, Futcher B, Tyers M
    Yeast G1 cyclins are unstable in G1 phase.
    Nature 1998 Sep 3;395(6697):86-9
    PMID: 9738503
  124. Ghiara JB, Richardson HE, Sugimoto K, Henze M, Lew DJ, Wittenberg C, Reed SI
    A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis.
    Cell 1991 Apr 5;65(1):163-74
    PMID: 1849458
  125. Moll T, Schwob E, Koch C, Moore A, Auer H, Nasmyth K
    Transcription factors important for starting the cell cycle in yeast.
    Philos Trans R Soc Lond B Biol Sci 1993 Jun 29;340(1293):351-60
    PMID: 8103939
  126. Kuhne C, Linder P
    A new pair of B-type cyclins from Saccharomyces cerevisiae that function early in the cell cycle.
    EMBO J 1993 Sep;12(9):3437-47
    PMID: 8253070
  127. Donaldson AD, Raghuraman MK, Friedman KL, Cross FR, Brewer BJ, Fangman WL
    CLB5-dependent activation of late replication origins in S. cerevisiae.
    Mol Cell 1998 Aug;2(2):173-82
    PMID: 9734354
  128. Ozer J, Lezina LE, Ewing J, Audi S, Lieberman PM
    Association of transcription factor IIA with TATA binding protein is required for transcriptional activation of a subset of promoters and cell cycle progression in Saccharomyces cerevisiae.
    Mol Cell Biol 1998 May;18(5):2559-70
    PMID: 9566876
  129. Leu JY, Roeder GS
    The pachytene checkpoint in S. cerevisiae depends on Swe1-mediated phosphorylation of the cyclin-dependent kinase Cdc28.
    Mol Cell 1999 Nov;4(5):805-14
    PMID: 10619027
  130. Loy CJ, Lydall D, Surana U
    NDD1, a high-dosage suppressor of cdc28-1N, is essential for expression of a subset of late-S-phase-specific genes in Saccharomyces cerevisiae.
    Mol Cell Biol 1999 May;19(5):3312-27
    PMID: 10207056
  131. Knapp D, Bhoite L, Stillman DJ, Nasmyth K
    The transcription factor Swi5 regulates expression of the cyclin kinase inhibitor p40SIC1.
    Mol Cell Biol 1996 Oct;16(10):5701-7
    PMID: 8816483
  132. Dahmann C, Diffley JF, Nasmyth KA
    S-phase-promoting cyclin-dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state.
    Curr Biol 1995 Nov 1;5(11):1257-69
    PMID: 8574583
  133. Guttmann-Raviv N, Boger-Nadjar E, Edri I, Kassir Y
    Cdc28 and Ime2 possess redundant functions in promoting entry into premeiotic DNA replication in Saccharomyces cerevisiae.
    Genetics 2001 Dec;159(4):1547-58
    PMID: 11779796
  134. Liu JH, Wei S, Burnette PK, Gamero AM, Hutton M, Djeu JY
    Functional association of TGF-beta receptor II with cyclin B.
    Oncogene 1999 Jan 7;18(1):269-75
    PMID: 9926943
  135. Krause K, Wasner M, Reinhard W, Haugwitz U, Dohna CL, Mossner J, Engeland K
    The tumour suppressor protein p53 can repress transcription of cyclin B.
    Nucleic Acids Res 2000 Nov 15;28(22):4410-8
    PMID: 11071927
  136. Draviam VM, Orrechia S, Lowe M, Pardi R, Pines J
    The localization of human cyclins B1 and B2 determines CDK1 substrate specificity and neither enzyme requires MEK to disassemble the Golgi apparatus.
    J Cell Biol 2001 Mar 5;152(5):945-58
    PMID: 11238451
  137. Sarafan-Vasseur N, Lamy A, Bourguignon J, Pessot FL, Hieter P, Sesboue R, Bastard C, Frebourg T, Flaman JM
    Overexpression of B-type cyclins alters chromosomal segregation.
    Oncogene 2002 Mar 27;21(13):2051-7
    PMID: 11960377
  138. Wang X, Krupczak-Hollis K, Tan Y, Dennewitz MB, Adami GR, Costa RH
    Increased hepatic Forkhead Box M1B (FoxM1B) levels in old-aged mice stimulated liver regeneration through diminished p27Kip1 protein levels and increased Cdc25B expression.
    J Biol Chem 2002 Nov 15;277(46):44310-6
    PMID: 12221098
  139. Nakanishi M, Ando H, Watanabe N, Kitamura K, Ito K, Okayama H, Miyamoto T, Agui T, Sasaki M
    Identification and characterization of human Wee1B, a new member of the Wee1 family of Cdk-inhibitory kinases.
    Genes Cells 2000 Oct;5(10):839-47
    PMID: 11029659
  140. Milatovich A, Francke U
    Human cyclin B1 gene (CCNB1) assigned to chromosome 5 (q13-qter).
    Somat Cell Mol Genet 1992 May;18(3):303-7
    PMID: 1386686
  141. Scharf JM, Damron D, Frisella A, Bruno S, Beggs AH, Kunkel LM, Dietrich WF
    The mouse region syntenic for human spinal muscular atrophy lies within the Lgn1 critical interval and contains multiple copies of Naip exon 5.
    Genomics 1996 Dec 15;38(3):405-17
    PMID: 8975718
  142. von Deimling F, Scharf JM, Liehr T, Rothe M, Kelter AR, Albers P, Dietrich WF, Kunkel LM, Wernert N, Wirth B
    Human and mouse RAD17 genes: identification, localization, genomic structure and histological expression pattern in normal testis and seminoma.
    Hum Genet 1999 Jul-Aug;105(1-2):17-27
    PMID: 10480350
  143. Hanley-Hyde J, Mushinski JF, Sadofsky M, Huppi K, Krall M, Kozak CA, Mock B
    Expression of murine cyclin B1 mRNAs and genetic mapping of related genomic sequences.
    Genomics 1992 Aug;13(4):1018-30
    PMID: 1387105
  144. Chapman DL, Wolgemuth DJ
    Isolation of the murine cyclin B2 cDNA and characterization of the lineage and temporal specificity of expression of the B1 and B2 cyclins during oogenesis, spermatogenesis and early embryogenesis.
    Development 1993 May;118(1):229-40
    PMID: 8375336
  145. Chapman DL, Wolgemuth DJ
    Identification of a mouse B-type cyclin which exhibits developmentally regulated expression in the germ line.
    Mol Reprod Dev 1992 Nov;33(3):259-69
    PMID: 1280449
  146. McVean M, Weinberg WC, Pelling JC
    A p21(waf1)-independent pathway for inhibitory phosphorylation of cyclin-dependent kinase p34(cdc2) and concomitant G(2)/M arrest by the chemopreventive flavonoid apigenin.
    Mol Carcinog 2002 Jan;33(1):36-43
    PMID: 11807956
  147. Chapman DL, Wolgemuth DJ
    Regulation of M-phase promoting factor activity during development of mouse male germ cells.
    Dev Biol 1994 Oct;165(2):500-6
    PMID: 7958416
  148. Scheurlen I, Hoffmeister SA, Schaller HC
    Presence and expression of G2 cyclins in the coelenterate hydra.
    J Cell Sci 1996 May;109 ( Pt 5):1063-9
    PMID: 8743953

 

Options:

 






 

BLASTN 2.2.5 [Nov-16-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
RID: 1048644792-020368-12002
Query= ORFN:YLR210W CLB4 SGDID:S0004200, Chr XII from 562008-563390
         (1383 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences) 
           1,709,165 sequences; 7,961,311,582 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|544497|gb|U14913.1|YSCH8167 Saccharomyces cerevisiae chromoso...  2742   0.0  
gi|171913|gb|M80303.1|YSCMCYBB Saccharomyces cerevisiae type B m...  2742   0.0  
gi|5526|emb|X69426.1|SCCLB4 S.cerevisiae CLB4 gene                   2742   0.0  
gi|13928049|emb|AL445074.4|CNS07ECX Human chromosome 14 DNA sequ...    44   0.57 
gi|22324979|gb|AC087061.22| Mus musculus chromosome 1 clone rp23...    42   2.3  
gi|25046363|gb|AC074311.28| Mus musculus chromosome 1 clone rp23...    42   2.3  
gi|23499674|gb|AC125078.2| Mus musculus chromosome 6 clone RP23-...    42   2.3  
gi|23575519|dbj|AK112427.1| Ciona intestinalis cDNA, clone:ciad0...    42   2.3  
gi|24060111|dbj|AP005438.3| Oryza sativa (japonica cultivar-grou...    42   2.3  
gi|3844917|gb|U39715.1|U39715 Mycoplasma genitalium section 37 o...    42   2.3  
gi|7594873|dbj|AB035255.1| Lentinula edodes gene for nuclease Le...    42   2.3  
gi|2983310|gb|AE000705.1| Aquifex aeolicus VF5 section 37 of 109...    40   8.9  
gi|15011824|gb|U41263.2| Caenorhabditis elegans cosmid T19D12, c...    40   8.9  
gi|27764785|gb|AC090983.13| Homo sapiens chromosome 15, clone RP...    40   8.9  
gi|21328441|gb|AC006452.5| Homo sapiens PAC clone RP4-592P3 from...    40   8.9  
gi|27597028|gb|AC090602.16| Homo sapiens chromosome 15, clone RP...    40   8.9  
gi|27478184|ref|XM_211787.1| Homo sapiens hypothetical gene supp...    40   8.9  
gi|17536336|ref|NM_062953.1| Caenorhabditis elegans sodium phosp...    40   8.9  
gi|22795236|gb|AC127460.2| Homo sapiens chromosome 5 clone RP11-...    40   8.9  
gi|18398631|ref|NM_127368.1| Arabidopsis thaliana chromosome 2  ...    40   8.9  
gi|19033969|gb|AC069286.7| Homo sapiens BAC clone RP11-261N10 fr...    40   8.9  
gi|20198200|gb|AC007212.7| Arabidopsis thaliana chromosome 2 clo...    40   8.9  
gi|20197593|gb|AC006201.4| Arabidopsis thaliana chromosome 2 clo...    40   8.9  
gi|19774293|gb|AC104640.3| Homo sapiens 3 BAC RP11-809F4 (Roswel...    40   8.9  
gi|15431203|gb|AC079760.6| Homo sapiens BAC clone RP11-142A5 fro...    40   8.9  
gi|13162556|gb|AC015982.9| Homo sapiens BAC clone RP11-554J4 fro...    40   8.9  
gi|24527684|emb|AL928719.6| Mouse DNA sequence from clone RP23-4...    40   8.9  
gi|8894643|emb|AL109942.13|HSJ473J16 Human DNA sequence from clo...    40   8.9  
gi|10334649|emb|AL109843.25|HSDJ763G1 Human DNA sequence from cl...    40   8.9  
gi|13396526|emb|AL356259.11| Human DNA sequence from clone RP11-...    40   8.9  
gi|10944193|emb|AL356956.11| Human DNA sequence from clone RP11-...    40   8.9  
gi|14485351|emb|AL499582.13| Human DNA sequence from clone RP11-...    40   8.9  
gi|16116424|emb|AL139381.24| Human DNA sequence from clone RP11-...    40   8.9  
gi|4298|emb|Z15007.1|SCREC104X S.cerevisiae REC104 gene                40   8.9  
gi|500647|gb|U10397.1|YSCH9666 Saccharomyces cerevisiae chromoso...    40   8.9  
gi|299060|gb|S58278.1|S58278 REC104=meiosis-specific gene [Sacch...    40   8.9  
gi|6002387|emb|AL121654.1|CNS01DS4 BAC sequence from the SPG4 ca...    40   8.9  

ALIGNMENTS
>gi|544497|gb|U14913.1|YSCH8167 Saccharomyces cerevisiae chromosome XII cosmid 8167
          Length = 38868

 Score = 2742 bits (1383), Expect = 0.0
 Identities = 1383/1383 (100%)
 Strand = Plus / Plus

                                                                         
Query: 1     atgatgcttgaagggtatacggtacaacctccacagtctactttgataggtgacattgaa 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23632 atgatgcttgaagggtatacggtacaacctccacagtctactttgataggtgacattgaa 23691

                                                                         
Query: 61    attcaggacgaaaatgcaaaccaagaagttaagaacgtactttaccaaggagttcaaaag 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23692 attcaggacgaaaatgcaaaccaagaagttaagaacgtactttaccaaggagttcaaaag 23751

                                                                         
Query: 121   ggtataaaaaggctagaaaaaagacaaaggagggttgcattaggtgatgtaacctctcaa 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23752 ggtataaaaaggctagaaaaaagacaaaggagggttgcattaggtgatgtaacctctcaa 23811

                                                                         
Query: 181   aaggcaaacaaaatacacaatgctatacataataaattccatcagacgaagaacaatttt 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23812 aaggcaaacaaaatacacaatgctatacataataaattccatcagacgaagaacaatttt 23871

                                                                         
Query: 241   gaaatagagaacatacgctcatcggccttggtaaaagaacaacaacgagacgtaaggcat 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23872 gaaatagagaacatacgctcatcggccttggtaaaagaacaacaacgagacgtaaggcat 23931

                                                                         
Query: 301   gaagatagcgactattttttaattgatagttctgaaggctcttctactgatgacgaacaa 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23932 gaagatagcgactattttttaattgatagttctgaaggctcttctactgatgacgaacaa 23991

                                                                         
Query: 361   gttaatgaagatgctattgatgatttgttaagtcgaagagtaaatgatcagcagattcaa 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23992 gttaatgaagatgctattgatgatttgttaagtcgaagagtaaatgatcagcagattcaa 24051

                                                                         
Query: 421   gccgatgaagtgtatgaagatttcgatggagaaatgcaagatgtcattgaagaggatgtt 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24052 gccgatgaagtgtatgaagatttcgatggagaaatgcaagatgtcattgaagaggatgtt 24111

                                                                         
Query: 481   gatagtcaaattgaaccactatcaccaataaacaacgatgaaattcagactgagctggac 540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24112 gatagtcaaattgaaccactatcaccaataaacaacgatgaaattcagactgagctggac 24171

                                                                         
Query: 541   agggcgtttgaaaaatattttcggtcggttcccaatccgctggatgatgatacccatgat 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24172 agggcgtttgaaaaatattttcggtcggttcccaatccgctggatgatgatacccatgat 24231

                                                                         
Query: 601   gttgtgatggttgtggagtacgcttccgacatattctattacttgagagaacttgaagtg 660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24232 gttgtgatggttgtggagtacgcttccgacatattctattacttgagagaacttgaagtg 24291

                                                                         
Query: 661   aaatataggcctaatccctactatatgcaaaatcaagtagagcttacatggccgttcaga 720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24292 aaatataggcctaatccctactatatgcaaaatcaagtagagcttacatggccgttcaga 24351

                                                                         
Query: 721   cgaactatgatagattggctagttcaactgcattttagatttcaacttttaccagaaacg 780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24352 cgaactatgatagattggctagttcaactgcattttagatttcaacttttaccagaaacg 24411

                                                                         
Query: 781   ctatacctgacgattaatatagtggatagatttctgtcaaagaagaccgttactttgaac 840
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24412 ctatacctgacgattaatatagtggatagatttctgtcaaagaagaccgttactttgaac 24471

                                                                         
Query: 841   aggtttcaattggttggtgtatcggctttatttattgctgccaagtttgaagagattaac 900
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24472 aggtttcaattggttggtgtatcggctttatttattgctgccaagtttgaagagattaac 24531

                                                                         
Query: 901   tgccccactttggatgatctagtttacatgctggaaaatacatacactagagatgacatt 960
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24532 tgccccactttggatgatctagtttacatgctggaaaatacatacactagagatgacatt 24591

                                                                         
Query: 961   attagagcggaacagtatatgatagatactctggaatttgaaataggttggccaggaccc 1020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24592 attagagcggaacagtatatgatagatactctggaatttgaaataggttggccaggaccc 24651

                                                                         
Query: 1021  atgccatttttaagaaggataagtaaagcagatgactatgacttcgaaccaagaacatta 1080
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24652 atgccatttttaagaaggataagtaaagcagatgactatgacttcgaaccaagaacatta 24711

                                                                         
Query: 1081  gcaaagtacttattggaaactacaatagtagaacccaaactagtggctgcggcaccaagc 1140
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24712 gcaaagtacttattggaaactacaatagtagaacccaaactagtggctgcggcaccaagc 24771

                                                                         
Query: 1141  tggttagctgctggcgcgtattttctgagcagaacaattcttggttcaaatgattggtct 1200
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24772 tggttagctgctggcgcgtattttctgagcagaacaattcttggttcaaatgattggtct 24831

                                                                         
Query: 1201  ttaaaacatgtattctactctggctatacatccagccaaataattcctttagcatcactg 1260
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24832 ttaaaacatgtattctactctggctatacatccagccaaataattcctttagcatcactg 24891

                                                                         
Query: 1261  atattggagaattgcaagaacgcatctcgacgccatcattcaatttggaaaaaatacttt 1320
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24892 atattggagaattgcaagaacgcatctcgacgccatcattcaatttggaaaaaatacttt 24951

                                                                         
Query: 1321  gaccaaaagcattaccgctgttctcaaattgtagaagaatggattgtttcgacagaagcc 1380
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24952 gaccaaaagcattaccgctgttctcaaattgtagaagaatggattgtttcgacagaagcc 25011

                
Query: 1381  taa 1383
             |||
Sbjct: 25012 taa 25014


>gi|171913|gb|M80303.1|YSCMCYBB Saccharomyces cerevisiae type B mitotic cyclin gene, complete cds
          Length = 1833

 Score = 2742 bits (1383), Expect = 0.0
 Identities = 1383/1383 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgatgcttgaagggtatacggtacaacctccacagtctactttgataggtgacattgaa 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301  atgatgcttgaagggtatacggtacaacctccacagtctactttgataggtgacattgaa 360

                                                                        
Query: 61   attcaggacgaaaatgcaaaccaagaagttaagaacgtactttaccaaggagttcaaaag 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361  attcaggacgaaaatgcaaaccaagaagttaagaacgtactttaccaaggagttcaaaag 420

                                                                        
Query: 121  ggtataaaaaggctagaaaaaagacaaaggagggttgcattaggtgatgtaacctctcaa 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421  ggtataaaaaggctagaaaaaagacaaaggagggttgcattaggtgatgtaacctctcaa 480

                                                                        
Query: 181  aaggcaaacaaaatacacaatgctatacataataaattccatcagacgaagaacaatttt 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481  aaggcaaacaaaatacacaatgctatacataataaattccatcagacgaagaacaatttt 540

                                                                        
Query: 241  gaaatagagaacatacgctcatcggccttggtaaaagaacaacaacgagacgtaaggcat 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541  gaaatagagaacatacgctcatcggccttggtaaaagaacaacaacgagacgtaaggcat 600

                                                                        
Query: 301  gaagatagcgactattttttaattgatagttctgaaggctcttctactgatgacgaacaa 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 601  gaagatagcgactattttttaattgatagttctgaaggctcttctactgatgacgaacaa 660

                                                                        
Query: 361  gttaatgaagatgctattgatgatttgttaagtcgaagagtaaatgatcagcagattcaa 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 661  gttaatgaagatgctattgatgatttgttaagtcgaagagtaaatgatcagcagattcaa 720

                                                                        
Query: 421  gccgatgaagtgtatgaagatttcgatggagaaatgcaagatgtcattgaagaggatgtt 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 721  gccgatgaagtgtatgaagatttcgatggagaaatgcaagatgtcattgaagaggatgtt 780

                                                                        
Query: 481  gatagtcaaattgaaccactatcaccaataaacaacgatgaaattcagactgagctggac 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 781  gatagtcaaattgaaccactatcaccaataaacaacgatgaaattcagactgagctggac 840

                                                                        
Query: 541  agggcgtttgaaaaatattttcggtcggttcccaatccgctggatgatgatacccatgat 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 841  agggcgtttgaaaaatattttcggtcggttcccaatccgctggatgatgatacccatgat 900

                                                                        
Query: 601  gttgtgatggttgtggagtacgcttccgacatattctattacttgagagaacttgaagtg 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 901  gttgtgatggttgtggagtacgcttccgacatattctattacttgagagaacttgaagtg 960

                                                                        
Query: 661  aaatataggcctaatccctactatatgcaaaatcaagtagagcttacatggccgttcaga 720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 961  aaatataggcctaatccctactatatgcaaaatcaagtagagcttacatggccgttcaga 1020

                                                                        
Query: 721  cgaactatgatagattggctagttcaactgcattttagatttcaacttttaccagaaacg 780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 cgaactatgatagattggctagttcaactgcattttagatttcaacttttaccagaaacg 1080

                                                                        
Query: 781  ctatacctgacgattaatatagtggatagatttctgtcaaagaagaccgttactttgaac 840
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1081 ctatacctgacgattaatatagtggatagatttctgtcaaagaagaccgttactttgaac 1140

                                                                        
Query: 841  aggtttcaattggttggtgtatcggctttatttattgctgccaagtttgaagagattaac 900
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1141 aggtttcaattggttggtgtatcggctttatttattgctgccaagtttgaagagattaac 1200

                                                                        
Query: 901  tgccccactttggatgatctagtttacatgctggaaaatacatacactagagatgacatt 960
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1201 tgccccactttggatgatctagtttacatgctggaaaatacatacactagagatgacatt 1260

                                                                        
Query: 961  attagagcggaacagtatatgatagatactctggaatttgaaataggttggccaggaccc 1020
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1261 attagagcggaacagtatatgatagatactctggaatttgaaataggttggccaggaccc 1320

                                                                        
Query: 1021 atgccatttttaagaaggataagtaaagcagatgactatgacttcgaaccaagaacatta 1080
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1321 atgccatttttaagaaggataagtaaagcagatgactatgacttcgaaccaagaacatta 1380

                                                                        
Query: 1081 gcaaagtacttattggaaactacaatagtagaacccaaactagtggctgcggcaccaagc 1140
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1381 gcaaagtacttattggaaactacaatagtagaacccaaactagtggctgcggcaccaagc 1440

                                                                        
Query: 1141 tggttagctgctggcgcgtattttctgagcagaacaattcttggttcaaatgattggtct 1200
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1441 tggttagctgctggcgcgtattttctgagcagaacaattcttggttcaaatgattggtct 1500

                                                                        
Query: 1201 ttaaaacatgtattctactctggctatacatccagccaaataattcctttagcatcactg 1260
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1501 ttaaaacatgtattctactctggctatacatccagccaaataattcctttagcatcactg 1560

                                                                        
Query: 1261 atattggagaattgcaagaacgcatctcgacgccatcattcaatttggaaaaaatacttt 1320
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1561 atattggagaattgcaagaacgcatctcgac