MedBlast(0.8) Results

Direct References:

Hit Evalue SeqType References
U51921 0.0 N
J03926 0.0 N
NP_013256 0.0 P  
NP_013258 0.0 P  
NP_013259 0.0 P  
NP_013261 0.0 P  
P11163 0.0 P  
S68471 0.0 P  
AAB67479 0.0 P  
AAB67481 0.0 P  
AAB67482 0.0 P  
AAB67484 0.0 P  
AAA34438 1e-137 P  
NP_010607 2e-79 P  
P38986 2e-79 P  
S48513 2e-79 P  
CAA81794 2e-79 P  
AAB64757 2e-79 P  
NP_595021 6e-75 P  
T43404 6e-75 P  
CAA72692 6e-75 P  
CAB75867 6e-75 P  
CAD31749 1e-74 P  
CAD27911 6e-71 P  
NP_592784 6e-71 P  
T50284 6e-71 P  
AAF13924 6e-71 P  
CAB69634 6e-71 P  
NP_388151 1e-60 P  
O34482 1e-60 P  
F69754 1e-60 P  
BAA22230 1e-60 P  
CAB12063 1e-60 P  
P06608 3e-58 P  
A26054 3e-58 P  
CAA32884 3e-58 P  
CAA31239 5e-58 P  
1HFJ 5e-58 P
1HFJ 5e-58 P
1HFK 5e-58 P
1HFK 5e-58 P
1HFW 5e-58 P
1HFW 5e-58 P
1HFW 5e-58 P
1HFW 5e-58 P
1HG0 5e-58 P
1HG0 5e-58 P
1HG0 5e-58 P
1HG0 5e-58 P
1HG1 5e-58 P
1HG1 5e-58 P
1HG1 5e-58 P
1HG1 5e-58 P
1JSL 5e-58 P
1JSL 5e-58 P
1JSL 5e-58 P
1JSL 5e-58 P
1JSR 5e-58 P
1JSR 5e-58 P
1JSR 5e-58 P
1JSR 5e-58 P
1O7J 5e-58 P  
1O7J 5e-58 P  
1O7J 5e-58 P  
1O7J 5e-58 P  
NP_462499 4e-57 P  
AAL22458 4e-57 P  
NP_799884 8e-56 P  
BAC61717 8e-56 P  
AAA62276 4e-52 P  
NP_417432 9e-52 P  
P00805 9e-52 P  
XDEC 9e-52 P  
AAA23445 9e-52 P  
AAA24062 9e-52 P  
AAA69124 9e-52 P  
AAC75994 9e-52 P  
3ECA 1e-51 P  
3ECA 1e-51 P  
3ECA 1e-51 P  
3ECA 1e-51 P  
NP_755418 3e-51 P  
AAN81991 3e-51 P  
NP_708728 3e-51 P  
AAN44435 3e-51 P  
NP_289529 3e-51 P  
NP_311860 3e-51 P  
A98108 3e-51 P  
D85953 3e-51 P
AAG58088 3e-51 P  
BAB37256 3e-51 P  
NP_404979 3e-51 P  
NP_670088 3e-51 P  
AD0169 3e-51 P  
CAC90215 3e-51 P  
AAM86339 3e-51 P  
1HO3 3e-51 P
1HO3 3e-51 P
NP_457498 1e-50 P  
NP_462022 1e-50 P  
AB0879 1e-50 P  
AAL21981 1e-50 P  
CAD02930 1e-50 P  
4ECA 2e-50 P  
4ECA 2e-50 P  
4ECA 2e-50 P  
4ECA 2e-50 P  
NP_281251 4e-49 P  
H81418 4e-49 P  
CAB72522 4e-49 P  
NP_438904 4e-48 P  
P43843 4e-48 P  
A64090 4e-48 P  
AAC22403 4e-48 P  
P50286 4e-48 P  
S74205 4e-48 P
1WSA 4e-48 P  
1WSA 4e-48 P  
CAA58658 4e-48 P
CAA61503 4e-48 P  
NP_207517 8e-47 P  
O25424 8e-47 P  
C64610 8e-47 P  
AAD07772 8e-47 P  
NP_771590 1e-46 P  
BAC50215 1e-46 P  
NP_223379 5e-46 P  
Q9ZLB9 5e-46 P  
D71904 5e-46 P  
AAD06238 5e-46 P  
ZP_00029251 3e-44 P  
742507A 1e-43 P  
P10182 1e-43 P  
3PGA 6e-43 P
3PGA 6e-43 P
3PGA 6e-43 P
3PGA 6e-43 P
AAB31750 1e-42 P  
ZP_00086111 2e-42 P  
O68897 2e-42 P  
AAC33155 2e-42 P  
NP_744601 3e-41 P  
AAN68065 3e-41 P  
4PGA 9e-41 P  
4PGA 9e-41 P  
P10172 2e-40 P  
A28063 2e-40 P  
1AGX 2e-40 P  
NP_250028 3e-40 P  
C83478 3e-40 P  
AAG04726 3e-40 P  
1DJO 3e-40 P
1DJO 3e-40 P
1DJP 3e-40 P
1DJP 3e-40 P
ZP_00090997 5e-38 P  
ZP_00024043 8e-37 P  
NP_519427 2e-36 P  
CAD15008 2e-36 P  
ZP_00116453 1e-35 P  
NP_622618 4e-31 P  
AAM24222 4e-31 P  
ZP_00050642 1e-30 P  
NP_646184 1e-28 P  
BAB95232 1e-28 P  
NP_698936 3e-28 P  
AAN30851 3e-28 P  
NP_372003 3e-28 P  
NP_374593 3e-28 P  
G89926 3e-28 P  
BAB42572 3e-28 P  
BAB57641 3e-28 P  

References Summary:

  1. Johnston M, Hillier L, Riles L, Albermann K, Andre B, Ansorge W, Benes V, Bruckner M, Delius H, Dubois E, Dusterhoft A, Entian KD, Floeth M, Goffeau A, Hebling U, Heumann K, Heuss-Neitzel D, Hilbert H, Hilger F, Kleine K, Kotter P, Louis EJ, Messenguy F, Mewes HW, Hoheisel JD, et al
    The nucleotide sequence of Saccharomyces cerevisiae chromosome XII.
    Nature 1997 May 29;387(6632 Suppl):87-90
    PMID: 9169871
  2. Kim KW, Kamerud JQ, Livingston DM, Roon RJ
    Asparaginase II of Saccharomyces cerevisiae. Characterization of the ASP3 gene.
    J Biol Chem 1988 Aug 25;263(24):11948-53
    PMID: 3042786
  3. Jaskolski M, Kozak M, Lubkowski J, Palm G, Wlodawer A
    Structures of two highly homologous bacterial L-asparaginases: a case of enantiomorphic space groups.
    Acta Crystallogr D Biol Crystallogr 2001 Mar;57(Pt 3):369-77
    PMID: 11223513
  4. Aghaiypour K, Wlodawer A, Lubkowski J
    Structural basis for the activity and substrate specificity of Erwinia chrysanthemi L-asparaginase.
    Biochemistry 2001 May 15;40(19):5655-64
    PMID: 11341830
  5. Morimoto Y, Taniguchi H, Yamashiro Y, Ejiri K, Baba S, Arimoto Y
    Complements in non-insulin-dependent diabetes mellitus with complications.
    Diabetes Res Clin Pract 1988 Sep 5;5(3):233-8
    PMID: 3219993
  6. Aghaiypour K, Wlodawer A, Lubkowski J
    Do bacterial L-asparaginases utilize a catalytic triad Thr-Tyr-Glu?
    Biochim Biophys Acta 2001 Dec 17;1550(2):117-28
    PMID: 11755201
  7. Ma SP, Arakaki S, Makino Y, Fukunaga T
    Molecular epidemiology of Japanese encephalitis virus in Okinawa.
    Microbiol Immunol 1996;40(11):847-55
    PMID: 8985940
  8. Coletta PL, Shimeld SM, Chaudhuri C, Muller U, Clarke JP, Sharpe PT
    Characterisation of the murine Hox-3.3 gene and its promoter.
    Mech Dev 1991 Sep;35(2):129-42
    PMID: 1684715
  9. Kucuk O, Fisher E, Moinpour CM, Coleman D, Hussain MH, Sartor AO, Chatta GS, Lowe BA, Eisenberger MA, Crawford ED
    Phase II trial of bicalutamide in patients with advanced prostate cancer in whom conventional hormonal therapy failed: a Southwest Oncology Group study (SWOG 9235).
    Urology 2001 Jul;58(1):53-8
    PMID: 11445479
  10. Gomez-Casati DF, Preiss J, Iglesias AA
    Studies on the effect of temperature on the activity and stability of cyanobacterial ADP-glucose pyrophosphorylase.
    Arch Biochem Biophys 2000 Dec 15;384(2):319-26
    PMID: 11368319
  11. Garrido-Pertierra A
    Isolation and properties of Salmonella typhimurium mutants defective in enolase.
    Rev Esp Fisiol 1980 Mar;36(1):33-9
    PMID: 6994178
  12. Jaworowski A, Rose IA
    Partition kinetics of ribulose-1,5-bisphosphate carboxylase from Rhodospirillum rubrum.
    J Biol Chem 1985 Jan 25;260(2):944-8
    PMID: 3918036
  13. Gregory JD, Serpersu EH
    Arrangement of substrates at the active site of yeast phosphoglycerate kinase. Effect of sulfate ion.
    J Biol Chem 1993 Feb 25;268(6):3880-8
    PMID: 8382681
  14. Rusev R, Donev S, Bonev M, Sivriev I
    [Kinetics of triphosphoglyceric acid formation in Chlorella pyrenoidosa (in vivo) during alternation of light and darkness]
    Biofizika 1980 May-Jun;25(3):446-50
    PMID: 7397261
  15. Rusev R, Bonev M, Sivriev I, Donev S
    [Light activation of the enzyme ribulose diphosphate carboxylase]
    Biofizika 1980 May-Jun;25(3):451-4
    PMID: 7397262
  16. Otani M, Umezawa C, Sano K
    A highly sensitive method for detection of 32P incorporation into acid-soluble compounds and its application to evaluate ATP-forming ability of Bacillus megaterium QM B1551 spores at the very early stage of germination.
    Microbiol Immunol 1987;31(10):967-74
    PMID: 3123896
  17. Theodorou ME, Kruger NJ
    Physiological relevance of fructose 2,6-bisphosphate in the regulation of spinach leaf pyrophosphate:fructose 6-phosphate 1-phosphotransferase.
    Planta 2001 May;213(1):147-57
    PMID: 11523651
  18. Jedrzejas MJ, Chander M, Setlow P, Krishnasamy G
    Structure and mechanism of action of a novel phosphoglycerate mutase from Bacillus stearothermophilus.
    EMBO J 2000 Apr 3;19(7):1419-31
    PMID: 10747010
  19. Casati DF, Aon MA, Iglesias AA
    Kinetic and structural analysis of the ultrasensitive behaviour of cyanobacterial ADP-glucose pyrophosphorylase.
    Biochem J 2000 Aug 15;350 Pt 1:139-47
    PMID: 10926837
  20. Singh SP, Snyder AK
    Interrelation between the effects of ethanol and thyroid hormones on gluconeogenesis from alanine in perfused rat liver.
    J Lab Clin Med 1982 May;99(5):746-53
    PMID: 7069271
  21. Oh YK, Freese E
    Manganese requirement of phosphoglycerate phosphomutase and its consequences for growth and sporulation of Bacillus subtilis.
    J Bacteriol 1976 Aug;127(2):739-46
    PMID: 182667
  22. Gomez Casati, Aon MA, Iglesias AA
    Ultrasensitive glycogen synthesis in Cyanobacteria.
    FEBS Lett 1999 Mar 5;446(1):117-21
    PMID: 10100626
  23. Ball KL, Preiss J
    Evidence for an arginine residue at the allosteric sites of spinach leaf ADPglucose pyrophosphorylase.
    J Protein Chem 1992 Jun;11(3):231-8
    PMID: 1326986
  24. Lawrence BA, Polse J, DePina A, Allen MM, Kolodny NH
    31P NMR identification of metabolites and pH determination in the cyanobacterium Synechocystis sp. PCC 6308.
    Curr Microbiol 1997 May;34(5):280-3
    PMID: 9099627
  25. Magill NG, Cowan AE, Leyva-Vazquez MA, Brown M, Koppel DE, Setlow P
    Analysis of the relationship between the decrease in pH and accumulation of 3-phosphoglyceric acid in developing forespores of Bacillus species.
    J Bacteriol 1996 Apr;178(8):2204-10
    PMID: 8636019
  26. Srivastava SK, Ansari NH, Hair GA, Awasthi S, Das B
    Activation of human erythrocyte, brain, aorta, muscle, and ocular tissue aldose reductase.
    Metabolism 1986 Apr;35(4 Suppl 1):114-8
    PMID: 3083202
  27. Geigenberger P, Geiger M, Stitt M
    High-temperature perturbation of starch synthesis is attributable to inhibition of ADP-glucose pyrophosphorylase by decreased levels of glycerate-3-phosphate in growing potato tubers
    Plant Physiol 1998 Aug;117(4):1307-16
    PMID: 9701586
  28. Ortlund E, Lacount MW, Lewinski K, Lebioda L
    Reactions of Pseudomonas 7A glutaminase-asparaginase with diazo analogues of glutamine and asparagine result in unexpected covalent inhibitions and suggests an unusual catalytic triad Thr-Tyr-Glu.
    Biochemistry 2000 Feb 15;39(6):1199-204
    PMID: 10684596

 

Indirect References:

Hit Evalue SeqType References
U51921 0.0 N
J03926 0.0 N  
NP_013256 0.0 P
  • asp3-1p (-)
  • asp3 (...)
  • asp3p (-)
  • asp3-1 (...)
NP_013258 0.0 P
  • asp3-2 (...)
  • asp3-2p (-)
  • asp3 (...)
  • asp3p (-)
NP_013259 0.0 P
  • asp3-3 (...)
  • asp3 (...)
  • asp3-3p (-)
  • asp3p (-)
NP_013261 0.0 P
  • asp3-4 (-)
  • asp3 (...)
  • asp3-4p (-)
  • asp3p (-)
P11163 0.0 P  
S68471 0.0 P  
AAB67479 0.0 P
  • asp3-1p (-)
  • asp3-2p (-)
  • asp3-3p (-)
  • asp3p (-)
  • asp3-4p (-)
  • asp3-1 (...)
  • asp3-2 (...)
  • asp3-3 (...)
  • asp3-4 (-)
  • asp3 (...)
AAB67481 0.0 P
  • asp3-1p (-)
  • asp3-2p (-)
  • asp3-3p (-)
  • asp3p (-)
  • asp3-4p (-)
  • asp3-1 (...)
  • asp3-2 (...)
  • asp3-3 (...)
  • asp3-4 (-)
  • asp3 (...)
AAB67482 0.0 P
  • asp3-1p (-)
  • asp3-2p (-)
  • asp3-3p (-)
  • asp3p (-)
  • asp3-4p (-)
  • asp3-1 (...)
  • asp3-2 (...)
  • asp3-3 (...)
  • asp3-4 (-)
  • asp3 (...)
AAB67484 0.0 P
  • asp3-1p (-)
  • asp3-2p (-)
  • asp3-3p (-)
  • asp3p (-)
  • asp3-4p (-)
  • asp3-1 (...)
  • asp3-2 (...)
  • asp3-3 (...)
  • asp3-4 (-)
  • asp3 (...)
AAA34438 1e-137 P  
NP_010607 2e-79 P
P38986 2e-79 P  
S48513 2e-79 P  
CAA81794 2e-79 P  
AAB64757 2e-79 P
  • asp1 (...)
  • asp1p (...)
NP_595021 6e-75 P  
T43404 6e-75 P  
CAA72692 6e-75 P  
CAB75867 6e-75 P  
CAD31749 1e-74 P  
CAD27911 6e-71 P  
NP_592784 6e-71 P  
T50284 6e-71 P  
AAF13924 6e-71 P  
CAB69634 6e-71 P  
NP_388151 1e-60 P
O34482 1e-60 P  
F69754 1e-60 P  
BAA22230 1e-60 P
  • yccc (...)
CAB12063 1e-60 P
  • yccc (...)
P06608 3e-58 P  
A26054 3e-58 P  
CAA32884 3e-58 P  
CAA31239 5e-58 P  
1HFJ 5e-58 P  
1HFJ 5e-58 P  
1HFK 5e-58 P  
1HFK 5e-58 P  
1HFW 5e-58 P  
1HFW 5e-58 P  
1HFW 5e-58 P  
1HFW 5e-58 P  
1HG0 5e-58 P  
1HG0 5e-58 P  
1HG0 5e-58 P  
1HG0 5e-58 P  
1HG1 5e-58 P  
1HG1 5e-58 P  
1HG1 5e-58 P  
1HG1 5e-58 P  
1JSL 5e-58 P  
1JSL 5e-58 P  
1JSL 5e-58 P  
1JSL 5e-58 P  
1JSR 5e-58 P  
1JSR 5e-58 P  
1JSR 5e-58 P  
1JSR 5e-58 P  
1O7J 5e-58 P  
1O7J 5e-58 P  
1O7J 5e-58 P  
1O7J 5e-58 P  
NP_462499 4e-57 P
  • stm3598 (-)
AAL22458 4e-57 P
  • stm3598 (-)
NP_799884 8e-56 P
  • vpa0374 (-)
BAC61717 8e-56 P
  • vpa0374 (-)
AAA62276 4e-52 P  
NP_417432 9e-52 P
P00805 9e-52 P  
XDEC 9e-52 P  
AAA23445 9e-52 P  
AAA24062 9e-52 P  
AAA69124 9e-52 P
  • ansb (...)
  • b2957 (-)
AAC75994 9e-52 P
  • ansb (...)
  • b2957 (-)
3ECA 1e-51 P  
3ECA 1e-51 P  
3ECA 1e-51 P  
3ECA 1e-51 P  
NP_755418 3e-51 P
  • ansb (...)
  • b2957 (-)
AAN81991 3e-51 P
  • ansb (...)
  • b2957 (-)
NP_708728 3e-51 P
  • ansb (...)
AAN44435 3e-51 P
  • ansb (...)
NP_289529 3e-51 P
  • ansb (...)
  • b2957 (-)
NP_311860 3e-51 P
  • ecs3833 (-)
A98108 3e-51 P  
D85953 3e-51 P  
AAG58088 3e-51 P
  • ansb (...)
  • b2957 (-)
BAB37256 3e-51 P
  • ecs3833 (-)
NP_404979 3e-51 P
  • ansb (...)
NP_670088 3e-51 P
  • ansb (...)
AD0169 3e-51 P  
CAC90215 3e-51 P
  • ansb (...)
AAM86339 3e-51 P
  • ansb (...)
1HO3 3e-51 P  
1HO3 3e-51 P  
NP_457498 1e-50 P
  • ansb (...)
NP_462022 1e-50 P
  • ansb (...)
AB0879 1e-50 P  
AAL21981 1e-50 P
  • ansb (...)
CAD02930 1e-50 P
  • sty3259 (-)
4ECA 2e-50 P  
4ECA 2e-50 P  
4ECA 2e-50 P  
4ECA 2e-50 P  
NP_281251 4e-49 P
  • ansa (-)
H81418 4e-49 P  
CAB72522 4e-49 P
  • ansa (-)
NP_438904 4e-48 P
  • hi0745 (-)
P43843 4e-48 P  
A64090 4e-48 P  
AAC22403 4e-48 P
  • hi0745 (-)
P50286 4e-48 P  
S74205 4e-48 P  
1WSA 4e-48 P  
1WSA 4e-48 P  
CAA58658 4e-48 P
  • ansa (-)
CAA61503 4e-48 P
  • ansa (-)
NP_207517 8e-47 P
  • hp0723 (-)
O25424 8e-47 P  
C64610 8e-47 P  
AAD07772 8e-47 P
  • hp0723 (-)
NP_771590 1e-46 P
  • bll4950 (-)
BAC50215 1e-46 P
  • bll4950 (-)
NP_223379 5e-46 P
  • ansb (...)
Q9ZLB9 5e-46 P  
D71904 5e-46 P  
AAD06238 5e-46 P
  • ansb (...)
ZP_00029251 3e-44 P
  • bcep2048 (-)
742507A 1e-43 P  
P10182 1e-43 P  
3PGA 6e-43 P  
3PGA 6e-43 P  
3PGA 6e-43 P  
3PGA 6e-43 P  
AAB31750 1e-42 P  
ZP_00086111 2e-42 P
  • pflu3378 (-)
O68897 2e-42 P  
AAC33155 2e-42 P  
NP_744601 3e-41 P
  • ansa (-)
AAN68065 3e-41 P
  • ansa (-)
4PGA 9e-41 P  
4PGA 9e-41 P  
P10172 2e-40 P  
A28063 2e-40 P  
1AGX 2e-40 P  
NP_250028 3e-40 P
  • ansb (...)
C83478 3e-40 P  
AAG04726 3e-40 P
  • ansb (...)
1DJO 3e-40 P  
1DJO 3e-40 P  
1DJP 3e-40 P  
1DJP 3e-40 P  
ZP_00090997 5e-38 P
  • avin2694 (-)
ZP_00024043 8e-37 P
  • reut3010 (-)
NP_519427 2e-36 P
  • ansb (...)
CAD15008 2e-36 P
  • rs02828 (-)
ZP_00116453 1e-35 P
  • synwh2055 (-)
NP_622618 4e-31 P
  • ansb (...)
AAM24222 4e-31 P
  • ansb (...)
ZP_00050642 1e-30 P
  • magn3303 (-)
NP_646184 1e-28 P
  • ansa (-)
BAB95232 1e-28 P
  • ansa (-)
NP_698936 3e-28 P
  • br1960 (-)
AAN30851 3e-28 P
  • br1960 (-)
NP_372003 3e-28 P
  • ansa (-)
NP_374593 3e-28 P
  • ansa (-)
G89926 3e-28 P  
BAB42572 3e-28 P
  • ansa (-)
BAB57641 3e-28 P
  • ansa (-)

References Summary:

  1. Kamerud JQ, Roon RJ
    Asparaginase II of Saccharomyces cerevisiae: selection of four mutations that cause derepressed enzyme synthesis.
    J Bacteriol 1986 Jan;165(1):293-6
    PMID: 3510190
  2. Oliveira EM, Martins AS, Carvajal E, Bon EP
    The role of the GATA factors Gln3p, Nil1p, Dal80p and the Ure2p on ASP3 regulation in Saccharomyces cerevisiae.
    Yeast 2003 Jan 15;20(1):31-7
    PMID: 12489124
  3. Sinclair K, Warner JP, Bonthron DT
    The ASP1 gene of Saccharomyces cerevisiae, encoding the intracellular isozyme of L-asparaginase.
    Gene 1994 Jun 24;144(1):37-43
    PMID: 8026756
  4. Jones GE
    Genetic and physiological relationships between L-asparaginase I and asparaginase II in Saccharomyces cerevisiae.
    J Bacteriol 1977 Apr;130(1):128-30
    PMID: 323221
  5. Kim KW, Roon RJ
    Asparaginase II of Saccharomyces cerevisiae: positive selection of two mutations that prevent enzyme synthesis.
    J Bacteriol 1984 Mar;157(3):958-61
    PMID: 6365897
  6. Besson F, Michel G
    Mycosubtilins B and C: minor antibiotics from mycosubtilin-producer Bacillus subtilis.
    Microbios 1990;62(251):93-9
    PMID: 2115097
  7. Bon EP, Carvajal E, Stanbrough M, Rowen D, Magasanik B
    Asparaginase II of Saccharomyces cerevisiae. GLN3/URE2 regulation of a periplasmic enzyme.
    Appl Biochem Biotechnol 1997 Spring;63-65:203-12
    PMID: 9170245
  8. Feoktistova A, McCollum D, Ohi R, Gould KL
    Identification and characterization of Schizosaccharomyces pombe asp1(+), a gene that interacts with mutations in the Arp2/3 complex and actin.
    Genetics 1999 Jul;152(3):895-908
    PMID: 10388810
  9. Brennan SO, Peach RJ, Bathurst IC
    Specificity of yeast KEX2 protease for variant human proalbumins is identical to the in vivo specificity of the hepatic proalbumin convertase.
    J Biol Chem 1990 Dec 15;265(35):21494-7
    PMID: 2254310
  10. Choi BS, Redfield AG
    Proton exchange and basepair kinetics of yeast tRNA(Phe) and tRNA(Asp1).
    J Biochem (Tokyo) 1995 Mar;117(3):515-20
    PMID: 7629016
  11. Fisher SH, Wray LV Jr
    Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.
    J Bacteriol 2002 Apr;184(8):2148-54
    PMID: 11914346
  12. Jennings MP, Beacham IR
    Co-dependent positive regulation of the ansB promoter of Escherichia coli by CRP and the FNR protein: a molecular analysis.
    Mol Microbiol 1993 Jul;9(1):155-64
    PMID: 8412660
  13. Green J, Irvine AS, Meng W, Guest JR
    FNR-DNA interactions at natural and semi-synthetic promoters.
    Mol Microbiol 1996 Jan;19(1):125-37
    PMID: 8821942
  14. Bonthron DT
    L-asparaginase II of Escherichia coli K-12: cloning, mapping and sequencing of the ansB gene.
    Gene 1990 Jul 2;91(1):101-5
    PMID: 2144836
  15. Jennings MP, Scott SP, Beacham IR
    Regulation of the ansB gene of Salmonella enterica.
    Mol Microbiol 1993 Jul;9(1):165-72
    PMID: 8412661
  16. Huser A, Kloppner U, Rohm KH
    Cloning, sequence analysis, and expression of ansB from Pseudomonas fluorescens, encoding periplasmic glutaminase/asparaginase.
    FEMS Microbiol Lett 1999 Sep 15;178(2):327-35
    PMID: 10499283
  17. Harms E, Wehner A, Jennings MP, Pugh KJ, Beacham IR, Rohm KH
    Construction of expression systems for Escherichia coli asparaginase II and two-step purification of the recombinant enzyme from periplasmic extracts.
    Protein Expr Purif 1991 Apr-Jun;2(2-3):144-50
    PMID: 1821783
  18. Jennings MP, Beacham IR
    Analysis of the Escherichia coli gene encoding L-asparaginase II, ansB, and its regulation by cyclic AMP receptor and FNR proteins.
    J Bacteriol 1990 Mar;172(3):1491-8
    PMID: 2407723
  19. Scott S, Busby S, Beacham I
    Transcriptional co-activation at the ansB promoters: involvement of the activating regions of CRP and FNR when bound in tandem.
    Mol Microbiol 1995 Nov;18(3):521-31
    PMID: 8748035
  20. Green J, Anjum MF, Guest JR
    Regulation of the ndh gene of Escherichia coli by integration host factor and a novel regulator, Arr.
    Microbiology 1997 Sep;143 ( Pt 9):2865-75
    PMID: 9308170

 

Options:

 




 

BLASTN 2.2.5 [Nov-16-2002] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. RID: 1048251059-026187-6512 Query= ORFN:YLR155C ASP3-1 SGDID:S0004145, Chr XII from 469318-470406, reverse complement (1089 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,707,549 sequences; 7,931,913,529 total letters Score E Sequences producing significant alignments: (bits) Value gi|1234842|gb|U51921.1|YSCL9362 Saccharomyces cerevisiae chromos... 2159 0.0 gi|171094|gb|J03926.1|YSCASP3A S.cerevisiae asparaginase II gene... 2127 0.0 gi|3840|emb|X01127.1|SCJ25S02 Yeast J2* 5S rRNA gene and flankin... 100 9e-18 gi|8649865|emb|AL138893.5| Human DNA sequence from clone RP11-15... 50 0.007 gi|23171805|gb|AE003732.2| Drosophila melanogaster chromosome 3R... 44 0.45 gi|24962919|gb|AC124681.3| Mus musculus chromosome 16 clone RP24... 44 0.45 gi|2879787|emb|AL021812.1|HSU86H4 Human DNA sequence from clone ... 44 0.45 gi|13027518|gb|AC009348.6|AC009348 Drosophila melanogaster, chro... 44 0.45 gi|28557825|gb|AC117457.11| Homo sapiens 3 BAC RP11-385J1 (Roswe... 42 1.8 gi|27877167|gb|AC009142.13| Homo sapiens chromosome 16 clone RP1... 42 1.8 gi|18481993|gb|AC087189.3| Homo sapiens chromosome 16 clone RP11... 42 1.8 gi|29125377|emb|BX000351.16| Mouse DNA sequence from clone RP23-... 42 1.8 gi|6634463|emb|AL117344.12|HSJ395C13 Human DNA sequence from clo... 42 1.8 gi|8468009|dbj|AP002482.1| Oryza sativa (japonica cultivar-group... 42 1.8 gi|8467930|dbj|AP002480.1| Oryza sativa (japonica cultivar-group... 42 1.8 gi|27713793|ref|XM_232621.1| Rattus norvegicus similar to RIKEN ... 40 7.0 gi|13236248|gb|AF318250.1| Cryptophyta gen. sp. Concarneau_14 24... 40 7.0 gi|23452213|gb|AF508210.1| Neurospora crassa suppressor of meiot... 40 7.0 gi|15055220|gb|AC026320.25| Homo sapiens 3 BAC RP11-655G22 (Rosw... 40 7.0 gi|18997207|gb|AC092937.8| Homo sapiens 3q BAC RP11-114F20 (Rosw... 40 7.0 gi|17986276|ref|NM_001846.1| Homo sapiens collagen, type IV, alp... 40 7.0 gi|9112238|gb|AE003851.1|AE003851 Xylella fastidiosa plasmid pXF... 40 7.0 gi|14517594|dbj|AP002469.3| Homo sapiens genomic DNA, chromosome... 40 7.0 gi|30075|emb|X05562.1|HSCOL4A2 Human mRNA for alpha-2 chain of c... 40 7.0 gi|18250453|emb|AL162714.34| Human DNA sequence from clone RP11-... 40 7.0 gi|13872933|dbj|AP003045.2| Oryza sativa (japonica cultivar-grou... 40 7.0 gi|21622324|emb|AL807366.1|NC94C8 Neurospora crassa DNA linkage ... 40 7.0 gi|21621677|emb|AL731711.11| Mouse DNA sequence from clone RP23-... 40 7.0 gi|10438573|dbj|AK025912.1| Homo sapiens cDNA: FLJ22259 fis, clo... 40 7.0 ALIGNMENTS >gi|1234842|gb|U51921.1|YSCL9362 Saccharomyces cerevisiae chromosome XII cosmid 9362 Length = 29427 Score = 2159 bits (1089), Expect = 0.0 Identities = 1089/1089 (100%) Strand = Plus / Minus Query: 1 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 5247 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 5188 Query: 61 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 5187 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 5128 Query: 121 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 5127 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 5068 Query: 181 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 5067 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 5008 Query: 241 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 5007 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 4948 Query: 301 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4947 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 4888 Query: 361 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4887 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 4828 Query: 421 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4827 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 4768 Query: 481 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4767 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 4708 Query: 541 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4707 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 4648 Query: 601 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4647 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 4588 Query: 661 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4587 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 4528 Query: 721 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4527 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 4468 Query: 781 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4467 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 4408 Query: 841 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4407 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 4348 Query: 901 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4347 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 4288 Query: 961 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4287 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 4228 Query: 1021 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4227 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 4168 Query: 1081 ggtggttaa 1089 ||||||||| Sbjct: 4167 ggtggttaa 4159 Score = 2159 bits (1089), Expect = 0.0 Identities = 1089/1089 (100%) Strand = Plus / Minus Query: 1 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14827 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 14768 Query: 61 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14767 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 14708 Query: 121 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14707 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 14648 Query: 181 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14647 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 14588 Query: 241 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14587 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 14528 Query: 301 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14527 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 14468 Query: 361 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14467 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 14408 Query: 421 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14407 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 14348 Query: 481 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14347 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 14288 Query: 541 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14287 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 14228 Query: 601 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14227 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 14168 Query: 661 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14167 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 14108 Query: 721 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14107 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 14048 Query: 781 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14047 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 13988 Query: 841 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13987 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 13928 Query: 901 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13927 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 13868 Query: 961 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13867 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 13808 Query: 1021 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13807 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 13748 Query: 1081 ggtggttaa 1089 ||||||||| Sbjct: 13747 ggtggttaa 13739 Score = 2159 bits (1089), Expect = 0.0 Identities = 1089/1089 (100%) Strand = Plus / Minus Query: 1 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18479 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 18420 Query: 61 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18419 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 18360 Query: 121 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18359 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 18300 Query: 181 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18299 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 18240 Query: 241 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18239 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 18180 Query: 301 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18179 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 18120 Query: 361 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18119 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 18060 Query: 421 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18059 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 18000 Query: 481 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17999 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 17940 Query: 541 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17939 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 17880 Query: 601 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17879 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 17820 Query: 661 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17819 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 17760 Query: 721 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17759 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 17700 Query: 781 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17699 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 17640 Query: 841 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17639 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 17580 Query: 901 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17579 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 17520 Query: 961 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17519 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 17460 Query: 1021 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17459 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 17400 Query: 1081 ggtggttaa 1089 ||||||||| Sbjct: 17399 ggtggttaa 17391 Score = 2159 bits (1089), Expect = 0.0 Identities = 1089/1089 (100%) Strand = Plus / Minus Query: 1 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1595 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 1536 Query: 61 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1535 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 1476 Query: 121 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1475 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 1416 Query: 181 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1415 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 1356 Query: 241 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1355 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 1296 Query: 301 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1295 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 1236 Query: 361 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1235 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 1176 Query: 421 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1175 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 1116 Query: 481 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1115 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 1056 Query: 541 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1055 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 996 Query: 601 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 995 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 936 Query: 661 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 935 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 876 Query: 721 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 875 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 816 Query: 781 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 815 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 756 Query: 841 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 755 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 696 Query: 901 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 695 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 636 Query: 961 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 635 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 576 Query: 1021 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 575 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 516 Query: 1081 ggtggttaa 1089 ||||||||| Sbjct: 515 ggtggttaa 507 >gi|171094|gb|J03926.1|YSCASP3A S.cerevisiae asparaginase II gene (ASP3), complete cds Length = 1738 Score = 2127 bits (1073), Expect = 0.0 Identities = 1086/1089 (99%), Gaps = 1/1089 (0%) Strand = Plus / Plus Query: 1 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 433 atgagatctttaaatacccttttactttctctctttgtcgcaatgtccagtggtgctcca 492 Query: 61 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 493 ctactaaaaattcgtgaagagaagaattcttctttgccatcaatcaaaatttttggtacc 552 Query: 121 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 553 ggcggtactatcgcttccaagggttcgacaagtgcaacaacggcgggttatagcgtggga 612 Query: 181 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 613 ttaaccgtaaatgatttaatagaagccgtcccatctttagctgagaaggcaaatctggac 672 Query: 241 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 673 tatcttcaagtgtctaacgttggttcaaattctttaaactatacgcatctgatcccattg 732 Query: 301 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 733 tatcacggtatctccgaggcactagcctctgatgactacgctggtgcggttgtcactcat 792 Query: 361 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 793 gggaccgacactatggaggagacagctttcttcttagatttgaccataaattcagagaag 852 Query: 421 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 853 ccagtatgtatcgcaggcgctatgcgtccagccactgccacgtctgctgatggcccaatg 912 Query: 481 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 913 aatttatatcaagcagtgtctattgctgcttctgagaaatcactgggtcgtggcacgatg 972 Query: 541 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 973 atcactctaaacgatcgtattgcctctgggttttggacaacgaaaatgaatgccaactct 1032 Query: 601 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1033 ttagatacattcagagcggatgaacagggatatttaggttacttttcaaatgatgacgtg 1092 Query: 661 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1093 gagttttactacccaccagtcaagccaaatggatggcaattttttgacatttccaacctc 1152 Query: 721 acagacccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 780 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1153 acaga-ccttcggaaattccagaagtcattattctgtactcctatcaaggcttgaatcct 1211 Query: 781 gagctaatagtaaaggccgtcaaggacctgggcgcaaaaggtatcgtgttggcgggttct 840 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1212 gagctaatagtaaaggccgtacaggacctgggcgcaaaaggtatcgtgttggcgggttct 1271 Query: 841 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1272 ggagctggttcctggactgctacgggtagtattgtaaacgaacaactttatgaagagtat 1331 Query: 901 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1332 ggtataccaattgttcacagcagaagaacagcagatggtacagttcctccagatgatgcc 1391 Query: 961 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1392 ccagagtacgccattggatctggctacctaaaccctcaaaaatcgcgtattttgctacaa 1451 Query: 1021 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1452 ttatgtttgtactccggctacggcatggatcagattaggtctgttttttctggcgtctac 1511 Query: 1081 ggtggttaa 1089 ||||||||| Sbjct: 1512 ggtggttaa 1520 >gi|3840|emb|X01127.1|SCJ25S02 Yeast J2* 5S rRNA gene and flanking sequence from 3.6 kb repeat Length = 919 Score = 99.6 bits (50), Expect = 9e-18 Identities = 50/50 (100%) Strand = Plus / Minus Query: 1040 acggcatggatcagattaggtctgttttttctggcgtctacggtggttaa 1089 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 919 acggcatggatcagattaggtctgttttttctggcgtctacggtggttaa 870 >gi|8649865|emb|AL138893.5| Human DNA sequence from clone RP11-159L16 on chromosome 9p21.1-21.3. Contains STSs and GSSs, complete sequence Length = 157039 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 218 tagctgagaaggcaaatctggacta 242 ||||||||||||||||||||||||| Sbjct: 105308 tagctgagaaggcaaatctggacta 105284 >gi|23171805|gb|AE003732.2| Drosophila melanogaster chromosome 3R, section 70 of 118 of the complete sequence Length = 224529 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 392 tcttagatttgaccataaattc 413 |||||||||||||||||||||| Sbjct: 165062 tcttagatttgaccataaattc 165083 >gi|24962919|gb|AC124681.3| Mus musculus chromosome 16 clone RP24-261H7, complete sequence Length = 173837 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 403 accataaattcagagaagccag 424 |||||||||||||||||||||| Sbjct: 16890 accataaattcagagaagccag 16911 >gi|2879787|emb|AL021812.1|HSU86H4 Human DNA sequence from clone LL0XNC01-86H4 on chromosome X, complete sequence Length = 45199 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 697 caattttttgacatttccaacc 718 |||||||||||||||||||||| Sbjct: 17638 caattttttgacatttccaacc 17659 >gi|13027518|gb|AC009348.6|AC009348 Drosophila melanogaster, chromosome 3R, region 93A-93B, BAC clone BACR05I01, complete sequence Length = 187151 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 392 tcttagatttgaccataaattc 413 |||||||||||||||||||||| Sbjct: 16730 tcttagatttgaccataaattc 16751 >gi|28557825|gb|AC117457.11| Homo sapiens 3 BAC RP11-385J1 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 204899 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 690 tggatggcaattttttgacatttcc 714 |||||||||| |||||||||||||| Sbjct: 90459 tggatggcaaatttttgacatttcc 90483 >gi|27877167|gb|AC009142.13| Homo sapiens chromosome 16 clone RP11-543N12, complete sequence Length = 195848 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 389 tcttcttagatttgaccataa 409 ||||||||||||||||||||| Sbjct: 161770 tcttcttagatttgaccataa 161790 >gi|18481993|gb|AC087189.3| Homo sapiens chromosome 16 clone RP11-43L5, complete sequence Length = 184877 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 389 tcttcttagatttgaccataa 409 ||||||||||||||||||||| Sbjct: 9206 tcttcttagatttgaccataa 9226 >gi|29125377|emb|BX000351.16| Mouse DNA sequence from clone RP23-313I4 on chromosome 11, complete sequence Length = 215122 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 887 tttatgaagagtatggtatac 907 ||||||||||||||||||||| Sbjct: 100834 tttatgaagagtatggtatac 100814 >gi|6634463|emb|AL117344.12|HSJ395C13 Human DNA sequence from clone RP3-395C13 on chromosome 6q25.2-26, complete sequence Length = 150336 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 ccttttactttctctctttgt 38 ||||||||||||||||||||| Sbjct: 43747 ccttttactttctctctttgt 43727 >gi|8468009|dbj|AP002482.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0706B05 Length = 187835 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 406 ataaattcagagaagccagta 426 ||||||||||||||||||||| Sbjct: 7725 ataaattcagagaagccagta 7745 >gi|8467930|dbj|AP002480.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0469E05 Length = 160769 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 406 ataaattcagagaagccagta 426 ||||||||||||||||||||| Sbjct: 158062 ataaattcagagaagccagta 158082 >gi|27713793|ref|XM_232621.1| Rattus norvegicus similar to RIKEN cDNA 6330565B14 [Mus musculus] (LOC312919), mRNA Length = 2535 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 702 ttttgacatttccaacctca 721 |||||||||||||||||||| Sbjct: 1312 ttttgacatttccaacctca 1293 >gi|13236248|gb|AF318250.1| Cryptophyta gen. sp. Concarneau_14 24S large subunit ribosomal RNA gene, partial sequence Length = 628 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1056 taggtctgttttttctggcg 1075 |||||||||||||||||||| Sbjct: 171 taggtctgttttttctggcg 190 >gi|23452213|gb|AF508210.1| Neurospora crassa suppressor of meiotic silencing (Sms-2) gene, complete cds Length = 5534 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 835 ggttctggagctggttcctg 854 |||||||||||||||||||| Sbjct: 2953 ggttctggagctggttcctg 2934 >gi|15055220|gb|AC026320.25| Homo sapiens 3 BAC RP11-655G22 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172681 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 698 aattttttgacatttccaac 717 |||||||||||||||||||| Sbjct: 74372 aattttttgacatttccaac 74353 >gi|18997207|gb|AC092937.8| Homo sapiens 3q BAC RP11-114F20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 188709 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 583 aaaatgaatgccaactctttagat 606 |||||||||||| ||||||||||| Sbjct: 33773 aaaatgaatgcctactctttagat 33796 >gi|17986276|ref|NM_001846.1| Homo sapiens collagen, type IV, alpha 2 (COL4A2), mRNA Length = 6276 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 806 acctgggcgcaaaaggtatc 825 |||||||||||||||||||| Sbjct: 3299 acctgggcgcaaaaggtatc 3318 >gi|9112238|gb|AE003851.1|AE003851 Xylella fastidiosa plasmid pXF51, complete sequence Length = 51158 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 132 cgcttccaagggttcgacaagtgc 155 ||||||||| |||||||||||||| Sbjct: 41523 cgcttccaatggttcgacaagtgc 41546 >gi|14517594|dbj|AP002469.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-266E8, complete sequence Length = 158977 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 ctttagctgagaaggcaaat 234 |||||||||||||||||||| Sbjct: 54788 ctttagctgagaaggcaaat 54807 >gi|30075|emb|X05562.1|HSCOL4A2 Human mRNA for alpha-2 chain of collagen IV N-terminus Length = 3416 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 806 acctgggcgcaaaaggtatc 825 |||||||||||||||||||| Sbjct: 3299 acctgggcgcaaaaggtatc 3318 >gi|18250453|emb|AL162714.34| Human DNA sequence from clone RP11-190K22 on chromosome 13, complete sequence Length = 64358 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 446 gtccagccactgccacgtctgctg 469 |||||||||||||||| ||||||| Sbjct: 32048 gtccagccactgccacatctgctg 32025 >gi|13872933|dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0030H07 Length = 168253 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 796 gccgtcaaggacctgggcgc 815 |||||||||||||||||||| Sbjct: 92011 gccgtcaaggacctgggcgc 92030 >gi|21622324|emb|AL807366.1|NC94C8 Neurospora crassa DNA linkage group V cosmid contig 94C8 Length = 80503 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 795 ggccgtcaaggacctgggcg 814 |||||||||||||||||||| Sbjct: 59620 ggccgtcaaggacctgggcg 59639 >gi|21621677|emb|AL731711.11| Mouse DNA sequence from clone RP23-55A17 on chromosome X, complete sequence Length = 209999 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 389 tcttcttagatttgaccata 408 |||||||||||||||||||| Sbjct: 170035 tcttcttagatttgaccata 170054 >gi|10438573|dbj|AK025912.1| Homo sapiens cDNA: FLJ22259 fis, clone HRC02935, highly similar to HUMCOL4A2P Human (clone pHAIV2-12) alpha-2 collagen type IV (COL4A2) mRNA Length = 3091 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 806 acctgggcgcaaaaggtatc 825 |||||||||||||||||||| Sbjct: 116 acctgggcgcaaaaggtatc 135 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) Posted date: Mar 20, 2003 10:39 PM Number of letters in database: -658,021,059 Number of sequences in database: 1,707,549 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,835,812 Number of Sequences: 1707549 Number of extensions: 4835812 Number of successful extensions: 21439 Number of sequences better than 10.0: 29 Number of HSP's better than 10.0 without gapping: 29 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 21402 Number of HSP's gapped (non-prelim): 36 length of query: 1089 length of database: 7,931,913,529 effective HSP length: 22 effective length of query: 1067 effective length of database: 7,894,347,451 effective search space: 8423268730217 effective search space used: 8423268730217 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)


 

BLASTX 2.2.5 [Nov-16-2002] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. RID: 1048255613-015604-3627 Query= ORFN:YLR155C ASP3-1 SGDID:S0004145, Chr XII from 469318-470406, reverse complement (1089 letters) Database: All non-redundant GenBank CDS translations+PDB+SwissProt+PIR+PRF 1,376,251 sequences; 442,128,549 total letters Score E Sequences producing significant alignments: (bits) Value gi|6323184|ref|NP_013256.1| nitrogen catabolite-regulated cell-w... 690 0.0 gi|171095|gb|AAA34438.1| asparaginase II precursor 479 e-137 gi|6320527|ref|NP_010607.1| Asparaginase I, intracellular isozym... 297 2e-79 gi|19115933|ref|NP_595021.1| l-asparaginase precursor [Schizosac... 282 6e-75 gi|20873643|emb|CAD31749.1| putative L-asparaginase; similar to ... 281 1e-74 gi|19572689|emb|CAD27911.1| putative L-asparaginase; similar to ... 269 6e-71 gi|19113696|ref|NP_592784.1| L-asparaginase precursor [Schizosac... 269 6e-71 gi|16077338|ref|NP_388151.1| similar to asparaginase [Bacillus s... 235 1e-60 gi|114275|sp|P06608|ASPG_ERWCH L-asparaginase precursor (L-aspar... 227 3e-58 gi|40994|emb|CAA31239.1| put. L-asparagine aminohydrolase precur... 226 5e-58 gi|12084598|pdb|1HFJ|A Chain A, Asparaginase From Erwinia Chrysa... 226 5e-58 gi|16766884|ref|NP_462499.1| putative L-asparaginase [Salmonella... 223 4e-57 gi|28900229|ref|NP_799884.1| periplasmic L-asparaginase II [Vibr... 219 8e-56 gi|668327|gb|AAA62276.1| chimeric immunoglobulin-L-asparaginase ... 206 4e-52 gi|16130858|ref|NP_417432.1| periplasmic L-asparaginase II [Esch... 205 9e-52 gi|443453|pdb|3ECA|A Chain A, Asparaginase Type Ii (E.C.3.5.1.1)... 205 1e-51 gi|26249378|ref|NP_755418.1| L-asparaginase II precursor [Escher... 204 3e-51 gi|24114218|ref|NP_708728.1| periplasmic L-asparaginase II [Shig... 204 3e-51 gi|15803496|ref|NP_289529.1| periplasmic L-asparaginase II [Esch... 204 3e-51 gi|16121666|ref|NP_404979.1| putative L-asparaginase II precurso... 204 3e-51 gi|13399487|pdb|1HO3|A Chain A, Crystal Structure Analysis Of E.... 203 3e-51 gi|16761881|ref|NP_457498.1| L-asparaginase [Salmonella enterica... 201 1e-50 gi|2392782|pdb|4ECA|A Chain A, Asparaginase From E. Coli, Mutant... 201 2e-50 gi|15791428|ref|NP_281251.1| cytoplasmic L-asparaginase [Campylo... 196 4e-49 gi|16272686|ref|NP_438904.1| L-asparaginase II (ansB) [Haemophil... 193 4e-48 gi|1703449|sp|P50286|ASPG_WOLSU L-asparaginase (L-asparagine ami... 193 4e-48 gi|15645344|ref|NP_207517.1| L-asparaginase II (ansB) [Helicobac... 189 8e-47 gi|27380061|ref|NP_771590.1| bll4950 [Bradyrhizobium japonicum] ... 188 1e-46 gi|15611728|ref|NP_223379.1| L-asparaginase II [Helicobacter pyl... 186 5e-46 gi|22984093|ref|ZP_00029251.1| hypothetical protein [Burkholderi... 180 3e-44 gi|229501|prf||742507A asparaginase 178 1e-43 gi|1168535|sp|P10182|ASPQ_PSES7 Glutaminase-asparaginase (PGA) 178 1e-43 gi|809338|pdb|3PGA|1 Chain 1, Glutaminase-Asparaginase (E.C.3.5.... 176 6e-43 gi|632685|gb|AAB31750.1| glutaminase-asparaginase, PGA=tetrameri... 175 1e-42 gi|23061256|ref|ZP_00086111.1| hypothetical protein [Pseudomonas... 174 2e-42 gi|6685241|sp|O68897|ASPG_PSEFL L-ASPARAGINASE PRECURSOR (L-ASPA... 174 2e-42 gi|26989176|ref|NP_744601.1| L-asparaginase II [Pseudomonas puti... 170 3e-41 gi|2392795|pdb|4PGA|A Chain A, Glutaminase-Asparaginase From Pse... 169 9e-41 gi|114277|sp|P10172|ASPQ_ACIGL Glutaminase-asparaginase >gi|7809... 168 2e-40 gi|15596534|ref|NP_250028.1| glutaminase-asparaginase [Pseudomon... 167 3e-40 gi|6980432|pdb|1DJO|A Chain A, Crystal Structure Of Pseudomonas ... 167 3e-40 gi|23104533|gb|ZP_00090997.1| hypothetical protein [Azotobacter ... 159 5e-38 gi|22978283|gb|ZP_00024043.1| hypothetical protein [Ralstonia me... 155 8e-37 gi|17546025|ref|NP_519427.1| PROBABLE L-ASPARAGINASE II PRECURSO... 154 2e-36 gi|23134679|ref|ZP_00116453.1| hypothetical protein [Synechococc... 151 1e-35 gi|20807447|ref|NP_622618.1| L-asparaginase/archaeal Glu-tRNAGln... 137 4e-31 gi|23009684|gb|ZP_00050642.1| hypothetical protein [Magnetospiri... 135 1e-30 gi|21283096|ref|NP_646184.1| probable L-asparaginase [Staphyloco... 128 1e-28 gi|23502809|ref|NP_698936.1| L-asparaginase type II, putative [B... 127 3e-28 gi|15924469|ref|NP_372003.1| probable L-asparaginase [Staphyloco... 127 3e-28 gi|21399413|ref|NP_655398.1| Asparaginase, Asparaginase [Bacillu... 127 4e-28 gi|231572|sp|P30363|ASPG_BACLI L-asparaginase (L-asparagine amid... 126 7e-28 gi|17986391|ref|NP_539025.1| L-ASPARAGINASE [Brucella melitensis... 125 1e-27 gi|15614187|ref|NP_242490.1| L-asparaginase [Bacillus halodurans... 125 1e-27 gi|27468085|ref|NP_764722.1| L-asparaginase [Staphylococcus epid... 121 2e-26 gi|16803979|ref|NP_465464.1| similar to asparaginase [Listeria ... 120 4e-26 gi|16801120|ref|NP_471388.1| similar to asparaginase [Listeria ... 120 4e-26 gi|15894991|ref|NP_348340.1| L-asparaginase [Clostridium acetobu... 120 5e-26 gi|28379230|ref|NP_786122.1| L-asparaginase [Lactobacillus plant... 117 2e-25 gi|22989548|ref|ZP_00034602.1| hypothetical protein [Burkholderi... 117 4e-25 gi|22958904|gb|ZP_00006565.1| hypothetical protein [Rhodobacter ... 115 9e-25 gi|15672718|ref|NP_266892.1| L-asparaginase [Lactococcus lactis ... 115 1e-24 gi|23502811|ref|NP_698938.1| asparaginase family protein [Brucel... 114 2e-24 gi|25011763|ref|NP_736158.1| Unknown [Streptococcus agalactiae N... 113 4e-24 gi|22537819|ref|NP_688670.1| asparaginase family protein [Strept... 113 4e-24 gi|15901821|ref|NP_346425.1| L-asparaginase, putative [Streptoco... 110 3e-23 gi|19746730|ref|NP_607866.1| putative L-asparaginase [Streptococ... 110 4e-23 gi|21911084|ref|NP_665352.1| putative L-asparaginase [Streptococ... 110 4e-23 gi|15675622|ref|NP_269796.1| putative L-asparaginase [Streptococ... 110 5e-23 gi|23023652|ref|ZP_00062885.1| hypothetical protein [Leuconostoc... 110 5e-23 gi|17986389|ref|NP_539023.1| L-ASPARAGINASE II [Brucella meliten... 108 2e-22 gi|15807344|ref|NP_296074.1| L-asparaginase [Deinococcus radiodu... 107 4e-22 gi|18203423|sp|Q9RRX9|ASPG_DEIRA Probable L-asparaginase (L-aspa... 104 2e-21 gi|18310734|ref|NP_562668.1| L-asparaginase [Clostridium perfrin... 103 5e-21 gi|24380193|ref|NP_722148.1| putative L-asparaginase [Streptococ... 103 6e-21 gi|14520908|ref|NP_126383.1| asparaginase [Pyrococcus abyssi] >g... 100 4e-20 gi|23099263|ref|NP_692729.1| L-asparaginase [Oceanobacillus ihey... 99 1e-19 gi|2644961|emb|CAA05766.1| L-asparaginase [Wolinella succinogenes] 98 2e-19 gi|25028595|ref|NP_738649.1| putative L-asparaginase [Corynebact... 97 6e-19 gi|26987895|ref|NP_743320.1| asparaginase family protein [Pseudo... 97 6e-19 gi|25028913|ref|NP_738967.1| putative L-asparaginase [Corynebact... 96 1e-18 gi|19553342|ref|NP_601344.1| L-asparaginase [Corynebacterium glu... 94 3e-18 gi|18978419|ref|NP_579776.1| l-asparaginase [Pyro