MedBlast Result

MedBlast(0.8) Results

Direct References
Indirect References
Options
BLASTN
BLASTX

Direct References:

Hit	Evalue	SeqType	References
Z72716	0.0	N
X91837	0.0	N	Proc Natl Acad Sci U S A 1996 Dec 10;93(25):14503-8 Yeast 1997 Jan;13(1):55-64
NP_011321	0.0	P
P53096	0.0	P
S64211	0.0	P
CAA96906	0.0	P
CAA62950	0.0	P
NP_594079	1e-141	P
O13298	1e-141	P
T11643	1e-141	P
BAA23598	1e-141	P
CAA15916	1e-141	P
AAF80490	1e-133	P
EAA01056	1e-129	P
P56520	1e-126	P
AAB96925	1e-126	P
AAN72014	1e-125	P
NP_651978	1e-125	P
AAF52023	1e-125	P
AAL28869	1e-125	P
AAC83649	1e-125	P
NP_003874	1e-124	P
O15379	1e-124	P
AAB88241	1e-124	P
AAC98927	1e-124	P
AAC26509	1e-124	P
AAH00614	1e-124	P
O88895	1e-124	P
JC7102	1e-124	P
AAC36305	1e-124	P
AAC67258	1e-124	P
NP_445900	1e-124	P
AAK11184	1e-124	P
JC5834	1e-124	P
AAC52038	1e-124	P
AAH44543	1e-123	P
AAF28798	1e-123	P
AAL33655	1e-123	P
NP_647918	1e-123	P
AAF47924	1e-123	P
AAL13716	1e-123	P
AAC61494	1e-123	P
AAF36425	1e-123	P
NP_004955	1e-122	P
Q13547	1e-122	P
AAC50475	1e-122	P
AAH00301	1e-122	P
NP_032254	1e-122	P
O09106	1e-122	P
CAA66870	1e-122	P
AAB88240	1e-122	P
EAA11382	1e-122	P
AAB99850	1e-122	P
P56517	1e-122	P
AAB96923	1e-122	P
AAC00504	1e-122	P
AAB68398	1e-122	P
NP_190054	1e-122	P
T47443	1e-122	P
CAB72470	1e-122	P
O42227	1e-121	P
AAC60346	1e-121	P
AAH41296	1e-121	P
BAA08909	1e-121	P
XP_123193	1e-121	P
AAC23917	1e-120	P
AAK58884	1e-120	P
Q94517	1e-120	P
CAA70455	1e-120	P
AAL89665	1e-119	P
AAM15960	1e-119	P
NP_775343	1e-119	P
AAM34645	1e-119	P
Q91695	1e-119	P
S60381	1e-119	P
CAA55211	1e-119	P
NP_032255	1e-118	P
P70288	1e-118	P
AAC52889	1e-118	P
NP_014069	1e-118	P
P32561	1e-118	P	Proc Natl Acad Sci U S A 1996 Dec 10;93(25):14503-8
S22284	1e-118	P
AAB20328	1e-118	P
CAA58228	1e-118	P
CAA96263	1e-118	P
AAH31055	1e-118	P
XP_237318	1e-118	P
AAK67142	1e-118	P
P56518	1e-117	P
AAB87685	1e-117	P
NP_001518	1e-117	P
Q92769	1e-117	P
AAC50814	1e-117	P
XP_216349	1e-116	P
AAL83942	1e-115	P
AAL56814	1e-115	P
AAF80489	1e-114	P
AAB66486	1e-113	P
AAG28474	1e-113	P

References Summary:

Rundlett SE, Carmen AA, Kobayashi R, Bavykin S, Turner BM, Grunstein M
HDA1 and RPD3 are members of distinct yeast histone deacetylase complexes that regulate silencing and transcription.
Proc Natl Acad Sci U S A 1996 Dec 10;93(25):14503-8
PMID: 8962081
Coglievina M, Klima R, Bertani I, Delneri D, Zaccaria P, Bruschi CV
Sequencing of a 40.5 kb fragment located on the left arm of chromosome VII from Saccharomyces cerevisiae.
Yeast 1997 Jan;13(1):55-64
PMID: 9046087

Indirect References:

Hit	Evalue	SeqType	References
Z72716	0.0	N	hos2 Proc Natl Acad Sci U S A 1996 Dec 10;93(25):14503-8 Genes Dev 2000 Nov 1;14(21):2737-44 Plant Cell 2001 Jul;13(7):1609-24 Science 2002 Nov 15;298(5597):1412-4 Genes Dev 2001 Nov 15;15(22):2991-3004 EMBO J 2000 Jun 15;19(12):3060-8 Cell 2002 May 17;109(4):437-46 hos2p (-) rtl1 (-) rtl1p (-)
X91837	0.0	N	g1330 (-)
NP_011321	0.0	P	hos2p (-) hos2 (...) rtl1 (-) rtl1p (-)
P53096	0.0	P
S64211	0.0	P
CAA96906	0.0	P	hos2 (...) hos2p (-) rtl1 (-) rtl1p (-)
CAA62950	0.0	P	g1330 (-)
NP_594079	1e-141	P	hda1 Mol Cell Biol 2002 Apr;22(7):2170-81 Nucleic Acids Res 2002 Dec 1;30(23):5036-55 Nucleic Acids Res 1998 Jul 1;26(13):3247-54
O13298	1e-141	P
T11643	1e-141	P
BAA23598	1e-141	P	phd1 FEBS Lett 1998 Oct 2;436(2):193-6
CAA15916	1e-141	P	hda1 (...)
AAF80490	1e-133	P	hosa Biochim Biophys Acta 2000 Jun 21;1492(1):120-6
EAA01056	1e-129	P	agcg53456 (-)
P56520	1e-126	P
AAB96925	1e-126	P
AAN72014	1e-125	P	at3g44680 (-)
NP_651978	1e-125	P	hdac3 Proc Natl Acad Sci U S A 2001 Aug 14;98(17):9730-5 Gene 1998 Oct 9;221(1):127-34
AAF52023	1e-125	P	hdac3 (...)
AAL28869	1e-125	P	hdac3 (...)
AAC83649	1e-125	P
NP_003874	1e-124	P	hdac3 (...) rpd3 Nature 1996 Dec 12;384(6609):589-91 Mol Cell 2002 Jan;9(1):45-57 Genomics 1999 Mar 1;56(2):197-202 Nat Genet 1999 Sep;23(1):62-6 J Biol Chem 2001 May 18;276(20):16731-8 Proc Natl Acad Sci U S A 2000 Feb 1;97(3):1056-61 FEBS Lett 1997 Dec 15;419(2-3):157-60 J Biol Chem 1999 Apr 23;274(17):11713-20 Dev Genes Evol 2001 Mar;211(3):109-17 Zygote 2001 May;9(2):123-33 Curr Biol 1998 Jul 2;8(14):843-6 Gene 2000 May 16;249(1-2):1-16 J Biol Chem 2001 Sep 21;276(38):35826-35 Dev Growth Differ 1998 Dec;40(6):583-90 Genomics 1998 Sep 1;52(2):245-6 Nature 1997 May 1;387(6628):43-8 Ageing Res Rev 2002 Jun;1(3):313-26 Exp Cell Res 2001 Jan 15;262(2):75-83 Proc Natl Acad Sci U S A 1998 Mar 17;95(6):2795-800 Biochemistry 2000 Feb 22;39(7):1683-92 Biochem Biophys Res Commun 1998 Jan 26;242(3):648-52 Science 1996 Apr 19;272(5260):371-2 FEBS Lett 1998 Oct 2;436(2):193-6 Proc Natl Acad Sci U S A 1999 Apr 27;96(9):4868-73 Science 1996 Apr 19;272(5260):408-11 Cold Spring Harb Symp Quant Biol 1998;63:391-9 Mol Cell Biol 1999 Sep;19(9):5847-60 EMBO J 2001 Jul 2;20(13):3506-17 Mol Cell 1998 Jun;1(7):1021-31 Proc Natl Acad Sci U S A 1996 Nov 12;93(23):12845-50 Biochem J 2000 Aug 15;350 Pt 1:199-205 Biochem Cell Biol 2001;79(3):243-52 EMBO J 1999 Sep 15;18(18):5099-107 Semin Cell Dev Biol 1999 Apr;10(2):179-88 Nucleic Acids Res 1997 Sep 15;25(18):3693-7 Proc Natl Acad Sci U S A 1999 Oct 26;96(22):12356-61 Cytogenet Cell Genet 1996;73(1-2):130-3 Nucleic Acids Res 1998 Jul 1;26(13):3247-54
O15379	1e-124	P
AAB88241	1e-124	P
AAC98927	1e-124	P	hdac3 (...) rpd3 (...)
AAC26509	1e-124	P	hdac3 (...) rpd3 (...)
AAH00614	1e-124	P
O88895	1e-124	P
JC7102	1e-124	P
AAC36305	1e-124	P	hdac3 (...)
AAC67258	1e-124	P	hdac3 (...)
NP_445900	1e-124	P	hdac3 (...)
AAK11184	1e-124	P	hdac3 (...)
JC5834	1e-124	P
AAC52038	1e-124	P	hdac3 (...) rpd3 (...)
AAH44543	1e-123	P
AAF28798	1e-123	P	hdac3 (...)
AAL33655	1e-123	P	hda102 (-)
NP_647918	1e-123	P	rpd3 (...)
AAF47924	1e-123	P	rpd3 (...)
AAL13716	1e-123	P	rpd3 (...)
AAC61494	1e-123	P	rpd3 (...)
AAF36425	1e-123	P	hdac3 (...)
NP_004955	1e-122	P	hd1 J Clin Oncol 1997 Jun;15(6):2275-87 Exp Cell Res 1999 Aug 1;250(2):298-312 Zhonghua Yi Xue Za Zhi 2002 Sep 10;82(17):1177-9 J Nurs Manag 2002 Mar;10(2):83-94 Eur J Cell Biol 1997 Oct;74(2):165-71 J Periodontol 2001 Jun;72(6):788-97 J Drug Educ 2001;31(2):207-20 Biochim Biophys Acta 1999 Mar 19;1430(2):157-78 J Biol Chem 2000 Feb 11;275(6):3887-95 Br J Dermatol 2000 May;142(5):991-1002 J Marital Fam Ther 2000 Jul;26(3):265-79 J Cell Sci 1998 Sep;111 ( Pt 18):2717-28 J Cell Biol 1998 Jul 13;142(1):271-84 Ann Oncol 1998;9 Suppl 5:S147-54 J Invest Dermatol 1999 Feb;112(2):153-6 Arch Dermatol Res 1999 Oct;291(10):531-7 J Dermatol Sci 2000 Dec;24(3):184-9 J Cell Sci 2000 Mar;113 ( Pt 6):963-73 Microsc Res Tech 1998 Nov 1;43(3):207-17 Exp Cell Res 1998 Mar 15;239(2):463-76 Nature 1997 May 1;387(6628):49-55 FEBS Lett 1998 Nov 13;439(1-2):138-42 J Cell Sci 1997 Aug;110 ( Pt 15):1705-16 Proc Natl Acad Sci U S A 1997 Jul 22;94(15):7879-84 Mol Biol Cell 1997 Apr;8(4):555-66 J Biomol Screen 2002 Jun;7(3):233-46 Appl Environ Microbiol 2001 Mar;67(3):1035-43 J Gerontol A Biol Sci Med Sci 2000 Jan;55(1):M28-33 Histochem J 1999 Feb;31(2):109-16 J Pathol 1998 Feb;184(2):191-6 Hum Reprod 2000 Mar;15(3):502-4 Exp Neurol 1999 Mar;156(1):92-9 J Biol Chem 2001 Nov 2;276(44):41336-42 Lab Invest 1997 Nov;77(5):459-68 Int J Dermatol 1998 May;37(5):364-9 Nucleic Acids Res 1997 Sep 15;25(18):3693-7 J Pharmacol Exp Ther 1998 Oct;287(1):167-86 Seikagaku 1999 Dec;71(12):1417-31 J Pharmacol Exp Ther 1998 Oct;287(1):187-97 Pflugers Arch 2002 Mar;443(5-6):875-81 [Total: 82. Click here for MORE] hdac1 Mol Cell Biol 2002 Aug;22(16):5975-88 EMBO J 2002 Sep 2;21(17):4621-31 EMBO J 2002 Jun 3;21(11):2682-91 Oncogene 2002 Sep 26;21(43):6703-12 Cancer Res 2002 Sep 1;62(17):4916-21 Cancer Res 2002 Nov 1;62(21):6231-9 J Biol Chem 2002 Jun 7;277(23):20974-8 Mol Cell Biol 2002 Mar;22(6):1804-18 Oncogene 2002 May 9;21(20):3232-40 J Biol Chem 2002 May 31;277(22):19618-26 Int J Oncol 2002 Oct;21(4):727-35 Genes Dev 2002 Nov 15;16(22):2893-905 J Biol Chem 2002 Aug 30;277(35):31826-33 Mol Cell Biol 2003 Feb;23(3):950-60 J Biol Chem 2002 Jul 19;277(29):25904-13 Mol Cell Biol 2003 Jan;23(1):250-8 Rinsho Ketsueki 2002 Apr;43(4):231-4 Am J Respir Crit Care Med 2002 Aug 1;166(3):392-6 J Biol Chem 2002 Sep 20;277(38):35434-9 Oncogene 2002 Dec 5;21(55):8388-96 Mol Cell Biol 2003 Feb;23(3):1025-33 J Biol Chem 2002 Aug 16;277(33):29550-4 Biochem Biophys Res Commun 2002 Aug 30;296(4):1005-12 Mol Cell Biol 2002 May;22(10):3373-88 Curr Biol 2002 Apr 2;12(7):594-8 J Biol Chem 2002 Dec 13;277(50):48714-23 Mol Cell Biol 2002 May;22(9):2965-73 Oncogene 2002 Mar 14;21(12):1812-22 Biochem J 2003 Feb 1;369(Pt 3):651-7 J Biol Chem 2002 Aug 16;277(33):29832-9 Genomics 2002 Mar;79(3):423-31 J Biol Chem 2002 Sep 6;277(36):33431-8 Mol Cell 2002 Mar;9(3):625-36 Nucleic Acids Res 2002 Aug 15;30(16):3602-8 Exp Cell Res 2002 Nov 1;280(2):149-58 J Biol Chem 2002 Aug 9;277(32):28733-41 Oncogene 2002 Oct 17;21(47):7241-6 Cancer Res 2002 Nov 15;62(22):6519-28 EMBO J 2002 Nov 15;21(22):6236-45 Nucleic Acids Res 2002 Sep 1;30(17):3831-8 [Total: 179. Click here for MORE] rpd3l1 Cytogenet Cell Genet 1996;73(1-2):130-3
Q13547	1e-122	P
AAC50475	1e-122	P
AAH00301	1e-122	P
NP_032254	1e-122	P	hdac1 (...)
O09106	1e-122	P
CAA66870	1e-122	P
AAB88240	1e-122	P	hrpd3-2a (-)
EAA11382	1e-122	P	ebig4321 (-)
AAB99850	1e-122	P	hdac1a (-)
P56517	1e-122	P
AAB96923	1e-122	P
AAC00504	1e-122	P	hdac1 (...)
AAB68398	1e-122	P	hd-1 Immunogenetics 1991;33(2):96-100 Leuk Lymphoma 2000 Jul;38(3-4):363-71 Differentiation 1998 May;63(1):1-11 J Biol Chem 2001 Jun 8;276(23):20523-8 Hum Mol Genet 1996 Oct;5(10):1539-46 Immunogenetics 1994;40(1):21-6 Clin Immunol 1999 Feb;90(2):157-64 Endocrinology 2001 Jan;142(1):319-31 hd1 (...) hd2 Infect Immun 1980 Aug;29(2):724-32 Hum Immunol 1986 Feb;15(2):150-63 Eur J Pharmacol 1991 Oct 29;204(1):15-20 Biochemistry 1999 May 25;38(21):6769-73 J Med Chem 2002 Apr 25;45(9):1778-84 Biochem Mol Biol Int 1999 Mar;47(3):493-500 J Pharmacol Exp Ther 1998 Oct;287(1):167-86 Br J Pharmacol 1994 Apr;111(4):1061-6 J Med Chem 2003 Feb 13;46(4):512-24 Hum Mol Genet 1995 Mar;4(3):465-9 rpd3 (...)
NP_190054	1e-122	P	at3g44680 (-)
T47443	1e-122	P
CAB72470	1e-122	P
O42227	1e-121	P
AAC60346	1e-121	P	rpd3 (...)
AAH41296	1e-121	P
BAA08909	1e-121	P
XP_123193	1e-121	P	loc225021 (-)
AAC23917	1e-120	P
AAK58884	1e-120	P	rpd3 (...)
Q94517	1e-120	P
CAA70455	1e-120	P	rpd3 (...)
AAL89665	1e-119	P
AAM15960	1e-119	P	hda1 (...)
NP_775343	1e-119	P	hdac1 (...)
AAM34645	1e-119	P	hdac1 (...)
Q91695	1e-119	P
S60381	1e-119	P
CAA55211	1e-119	P	ab21 (-)
NP_032255	1e-118	P	hdac2 Nucleic Acids Res 2000 May 15;28(10):2201-6 J Am Soc Nephrol 2002 Aug;13(8):2009-17 J Biol Chem 2002 Apr 26;277(17):14869-76 Cell 2002 Aug 23;110(4):479-88 J Biol Chem 1998 Oct 30;273(44):28921-30 J Biol Chem 1999 Jun 4;274(23):16646-53 Nucleic Acids Res 2001 Aug 1;29(15):3131-6 J Biol Chem 2002 Jun 28;277(26):23658-63 EMBO J 2002 Sep 2;21(17):4621-31 EMBO J 2002 Jun 3;21(11):2672-81 Biochem J 2003 Feb 1;369(Pt 3):651-7 Cancer Gene Ther 2002 Feb;9(2):117-25 J Mol Biol 2001 Apr 20;308(1):27-38 Biochem Biophys Res Commun 2002 Nov 29;299(2):263-7 J Cell Sci 2002 Aug 15;115(Pt 16):3319-30 Biochim Biophys Acta 1999 Dec 23;1489(2-3):365-73 Nat Genet 2000 Jul;25(3):269-77 Neuron 2001 Aug 16;31(3):353-65 Mol Cell 1998 Jul;2(1):33-42 Mol Cell Biol 2001 Oct;21(20):7065-77 Genes Dev 2001 May 1;15(9):1140-51 Biochem Biophys Res Commun 2001 Nov 9;288(4):921-6
P70288	1e-118	P
AAC52889	1e-118	P
NP_014069	1e-118	P	sds6 Genetics 1996 Dec;144(4):1343-53 sds6p (-) sdi2 Genetics 1994 Mar;136(3):781-8 Genetics 1996 Dec;144(4):1343-53 Cell 1987 Feb 27;48(4):579-87 rec3p (-) rec3 Curr Genet 1999 Mar;35(2):68-76 Curr Genet 1990 Jan;17(1):7-12 rpd3p Mol Cell Biol 2000 Mar;20(6):2147-57 Nucleic Acids Res 2000 Aug 15;28(16):3160-7 Mol Genet Genomics 2001 May;265(3):560-8 Mol Cell Biol 1997 Aug;17(8):4852-8 Genetics 2001 Feb;157(2):545-56 Mol Cell Biol 1998 Oct;18(10):5750-61 Mol Cell Biol 2003 Mar;23(5):1602-13 Genetics 1994 May;137(1):55-65 FEBS Lett 1998 Oct 2;436(2):193-6 Genes Dev 1999 Jun 1;13(11):1412-21 Science 1996 Apr 19;272(5260):408-11 Exp Gerontol 2002 Aug-Sep;37(8-9):1023-30 Proc Natl Acad Sci U S A 2000 Dec 5;97(25):13708-13 sdi2p (-) rpd3 (...)
P32561	1e-118	P
S22284	1e-118	P
AAB20328	1e-118	P	sds6 (...) sds6p (-) sdi2 (...) rec3p (-) rec3 (...) rpd3p (...) sdi2p (-) rpd3 (...)
CAA58228	1e-118	P	n0305 (-)
CAA96263	1e-118	P	sds6 (...) sds6p (-) sdi2 (...) rec3p (-) rec3 (...) rpd3p (...) sdi2p (-) rpd3 (...)
AAH31055	1e-118	P
XP_237318	1e-118	P	hdac1 (...)
AAK67142	1e-118	P	hda101 (-)
P56518	1e-117	P
AAB87685	1e-117	P	hdac1 (...)
NP_001518	1e-117	P	hdac2 (...) rpd3 (...) yaf1 (-)
Q92769	1e-117	P
AAC50814	1e-117	P
XP_216349	1e-116	P	loc297893 (-)
AAL83942	1e-115	P
AAL56814	1e-115	P
AAF80489	1e-114	P	rpda Biochim Biophys Acta 2000 Jun 21;1492(1):120-6
AAB66486	1e-113	P
AAG28474	1e-113	P	rpd3a (-)

References Summary:

Watson AD, Edmondson DG, Bone JR, Mukai Y, Yu Y, Du W, Stillman DJ, Roth SY
Ssn6-Tup1 interacts with class I histone deacetylases required for repression.
Genes Dev 2000 Nov 1;14(21):2737-44
PMID: 11069890
Baidyaroy D, Brosch G, Ahn JH, Graessle S, Wegener S, Tonukari NJ, Caballero O, Loidl P, Walton JD
A gene related to yeast HOS2 histone deacetylase affects extracellular depolymerase expression and virulence in a plant pathogenic fungus.
Plant Cell 2001 Jul;13(7):1609-24
PMID: 11449054
Wang A, Kurdistani SK, Grunstein M
Requirement of Hos2 histone deacetylase for gene activity in yeast.
Science 2002 Nov 15;298(5597):1412-4
PMID: 12434058
Pijnappel WW, Schaft D, Roguev A, Shevchenko A, Tekotte H, Wilm M, Rigaut G, Seraphin B, Aasland R, Stewart AF
The S. cerevisiae SET3 complex includes two histone deacetylases, Hos2 and Hst1, and is a meiotic-specific repressor of the sporulation gene program.
Genes Dev 2001 Nov 15;15(22):2991-3004
PMID: 11711434
Wittschieben BO, Fellows J, Du W, Stillman DJ, Svejstrup JQ
Overlapping roles for the histone acetyltransferase activities of SAGA and elongator in vivo.
EMBO J 2000 Jun 15;19(12):3060-8
PMID: 10856249
Robyr D, Suka Y, Xenarios I, Kurdistani SK, Wang A, Suka N, Grunstein M
Microarray deacetylation maps determine genome-wide functions for yeast histone deacetylases.
Cell 2002 May 17;109(4):437-46
PMID: 12086601
Bjerling P, Silverstein RA, Thon G, Caudy A, Grewal S, Ekwall K
Functional divergence between histone deacetylases in fission yeast by distinct cellular localization and in vivo specificity.
Mol Cell Biol 2002 Apr;22(7):2170-81
PMID: 11884604
Pandey R, Muller A, Napoli CA, Selinger DA, Pikaard CS, Richards EJ, Bender J, Mount DW, Jorgensen RA
Analysis of histone acetyltransferase and histone deacetylase families of Arabidopsis thaliana suggests functional diversification of chromatin modification among multicellular eukaryotes.
Nucleic Acids Res 2002 Dec 1;30(23):5036-55
PMID: 12466527
Olsson TG, Ekwall K, Allshire RC, Sunnerhagen P, Partridge JF, Richardson WA
Genetic characterisation of hda1+, a putative fission yeast histone deacetylase gene.
Nucleic Acids Res 1998 Jul 1;26(13):3247-54
PMID: 9628926
Kim YB, Honda A, Yoshida M, Horinouchi S
phd1+, a histone deacetylase gene of Schizosaccharomyces pombe, is required for the meiotic cell cycle and resistance to trichostatin A.
FEBS Lett 1998 Oct 2;436(2):193-6
PMID: 9781677
Graessle S, Dangl M, Haas H, Mair K, Trojer P, Brandtner EM, Walton JD, Loidl P, Brosch G
Characterization of two putative histone deacetylase genes from Aspergillus nidulans.
Biochim Biophys Acta 2000 Jun 21;1492(1):120-6
PMID: 11004483
Chang YL, Peng YH, Pan IC, Sun DS, King B, Huang DH
Essential role of Drosophila Hdac1 in homeotic gene silencing.
Proc Natl Acad Sci U S A 2001 Aug 14;98(17):9730-5
PMID: 11493709
Johnson CA, Barlow AL, Turner BM
Molecular cloning of Drosophila melanogaster cDNAs that encode a novel histone deacetylase dHDAC3.
Gene 1998 Oct 9;221(1):127-34
PMID: 9852957
De Rubertis F, Kadosh D, Henchoz S, Pauli D, Reuter G, Struhl K, Spierer P
The histone deacetylase RPD3 counteracts genomic silencing in Drosophila and yeast.
Nature 1996 Dec 12;384(6609):589-91
PMID: 8955276
Fischle W, Dequiedt F, Hendzel MJ, Guenther MG, Lazar MA, Voelter W, Verdin E
Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR.
Mol Cell 2002 Jan;9(1):45-57
PMID: 11804585
Mahlknecht U, Emiliani S, Najfeld V, Young S, Verdin E
Genomic organization and chromosomal localization of the human histone deacetylase 3 gene.
Genomics 1999 Mar 1;56(2):197-202
PMID: 10051405
Wade PA, Gegonne A, Jones PL, Ballestar E, Aubry F, Wolffe AP
Mi-2 complex couples DNA methylation to chromatin remodelling and histone deacetylation.
Nat Genet 1999 Sep;23(1):62-6
PMID: 10471500
Forzani C, Loulergue C, Lobreaux S, Briat JF, Lebrun M
Nickel resistance and chromatin condensation in Saccharomyces cerevisiae expressing a maize high mobility group I/Y protein.
J Biol Chem 2001 May 18;276(20):16731-8
PMID: 11278346
Zhou X, Richon VM, Rifkind RA, Marks PA
Identification of a transcriptional repressor related to the noncatalytic domain of histone deacetylases 4 and 5.
Proc Natl Acad Sci U S A 2000 Feb 1;97(3):1056-61
PMID: 10655483
Khochbin S, Wolffe AP
The origin and utility of histone deacetylases.
FEBS Lett 1997 Dec 15;419(2-3):157-60
PMID: 9428625
Fischle W, Emiliani S, Hendzel MJ, Nagase T, Nomura N, Voelter W, Verdin E
A new family of human histone deacetylases related to Saccharomyces cerevisiae HDA1p.
J Biol Chem 1999 Apr 23;274(17):11713-20
PMID: 10206986
Zhu W, Foehr M, Jaynes JB, Hanes SD
Drosophila SAP18, a member of the Sin3/Rpd3 histone deacetylase complex, interacts with Bicoid and inhibits its activity.
Dev Genes Evol 2001 Mar;211(3):109-17
PMID: 11455422
Segev H, Memili E, First NL
Expression patterns of histone deacetylases in bovine oocytes and early embryos, and the effect of their inhibition on embryo development.
Zygote 2001 May;9(2):123-33
PMID: 11358320
Wade PA, Jones PL, Vermaak D, Wolffe AP
A multiple subunit Mi-2 histone deacetylase from Xenopus laevis cofractionates with an associated Snf2 superfamily ATPase.
Curr Biol 1998 Jul 2;8(14):843-6
PMID: 9663395
Chen G, Courey AJ
Groucho/TLE family proteins and transcriptional repression.
Gene 2000 May 16;249(1-2):1-16
PMID: 10831834
Fischle W, Dequiedt F, Fillion M, Hendzel MJ, Voelter W, Verdin E
Human HDAC7 histone deacetylase activity is associated with HDAC3 in vivo.
J Biol Chem 2001 Sep 21;276(38):35826-35
PMID: 11466315
Nemer M
Histone deacetylase mRNA temporally and spatially regulated in its expression in sea urchin embryos.
Dev Growth Differ 1998 Dec;40(6):583-90
PMID: 9865968
Betz R, Gray SG, Ekstrom C, Larsson C, Ekstrom TJ
Human histone deacetylase 2, HDAC2 (Human RPD3), is localized to 6q21 by radiation hybrid mapping.
Genomics 1998 Sep 1;52(2):245-6
PMID: 9782097
Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG
A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression.
Nature 1997 May 1;387(6628):43-8
PMID: 9139820
Chang KT, Min KT
Regulation of lifespan by histone deacetylase.
Ageing Res Rev 2002 Jun;1(3):313-26
PMID: 12067588
Gray SG, Ekstrom TJ
The human histone deacetylase family.
Exp Cell Res 2001 Jan 15;262(2):75-83
PMID: 11139331
Emiliani S, Fischle W, Van Lint C, Al-Abed Y, Verdin E
Characterization of a human RPD3 ortholog, HDAC3.
Proc Natl Acad Sci U S A 1998 Mar 17;95(6):2795-800
PMID: 9501169
Lechner T, Lusser A, Pipal A, Brosch G, Loidl A, Goralik-Schramel M, Sendra R, Wegener S, Walton JD, Loidl P
RPD3-type histone deacetylases in maize embryos.
Biochemistry 2000 Feb 22;39(7):1683-92
PMID: 10677216
Dangond F, Hafler DA, Tong JK, Randall J, Kojima R, Utku N, Gullans SR
Differential display cloning of a novel human histone deacetylase (HDAC3) cDNA from PHA-activated immune cells.
Biochem Biophys Res Commun 1998 Jan 26;242(3):648-52
PMID: 9464271
Wolffe AP
Histone deacetylase: a regulator of transcription.
Science 1996 Apr 19;272(5260):371-2
PMID: 8602525
Grozinger CM, Hassig CA, Schreiber SL
Three proteins define a class of human histone deacetylases related to yeast Hda1p.
Proc Natl Acad Sci U S A 1999 Apr 27;96(9):4868-73
PMID: 10220385
Taunton J, Hassig CA, Schreiber SL
A mammalian histone deacetylase related to the yeast transcriptional regulator Rpd3p.
Science 1996 Apr 19;272(5260):408-11
PMID: 8602529
Suka N, Carmen AA, Rundlett SE, Grunstein M
The regulation of gene activity by histones and the histone deacetylase RPD3.
Cold Spring Harb Symp Quant Biol 1998;63:391-9
PMID: 10384304
Vermaak D, Wade PA, Jones PL, Shi YB, Wolffe AP
Functional analysis of the SIN3-histone deacetylase RPD3-RbAp48-histone H4 connection in the Xenopus oocyte.
Mol Cell Biol 1999 Sep;19(9):5847-60
PMID: 10454532
Formosa T, Eriksson P, Wittmeyer J, Ginn J, Yu Y, Stillman DJ
Spt16-Pob3 and the HMG protein Nhp6 combine to form the nucleosome-binding factor SPN.
EMBO J 2001 Jul 2;20(13):3506-17
PMID: 11432837
Zhang Y, Sun ZW, Iratni R, Erdjument-Bromage H, Tempst P, Hampsey M, Reinberg D
SAP30, a novel protein conserved between human and yeast, is a component of a histone deacetylase complex.
Mol Cell 1998 Jun;1(7):1021-31
PMID: 9651585
Yang WM, Inouye C, Zeng Y, Bearss D, Seto E
Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3.
Proc Natl Acad Sci U S A 1996 Nov 12;93(23):12845-50
PMID: 8917507
Buggy JJ, Sideris ML, Mak P, Lorimer DD, McIntosh B, Clark JM
Cloning and characterization of a novel human histone deacetylase, HDAC8.
Biochem J 2000 Aug 15;350 Pt 1:199-205
PMID: 10926844
Bertos NR, Wang AH, Yang XJ
Class II histone deacetylases: structure, function, and regulation.
Biochem Cell Biol 2001;79(3):243-52
PMID: 11467738
Miska EA, Karlsson C, Langley E, Nielsen SJ, Pines J, Kouzarides T
HDAC4 deacetylase associates with and represses the MEF2 transcription factor.
EMBO J 1999 Sep 15;18(18):5099-107
PMID: 10487761
Johnson CA, Turner BM
Histone deacetylases: complex transducers of nuclear signals.
Semin Cell Dev Biol 1999 Apr;10(2):179-88
PMID: 10441071
Leipe DD, Landsman D
Histone deacetylases, acetoin utilization proteins and acetylpolyamine amidohydrolases are members of an ancient protein superfamily.
Nucleic Acids Res 1997 Sep 15;25(18):3693-7
PMID: 9278492
Carmen AA, Griffin PR, Calaycay JR, Rundlett SE, Suka Y, Grunstein M
Yeast HOS3 forms a novel trichostatin A-insensitive homodimer with intrinsic histone deacetylase activity.
Proc Natl Acad Sci U S A 1999 Oct 26;96(22):12356-61
PMID: 10535926
Furukawa Y, Kawakami T, Sudo K, Inazawa J, Matsumine A, Akiyama T, Nakamura Y
Isolation and mapping of a human gene (RPD3L1) that is homologous to RPD3, a transcription factor in Saccharomyces cerevisiae.
Cytogenet Cell Genet 1996;73(1-2):130-3
PMID: 8646880
Loeffler M, Diehl V, Pfreundschuh M, Ruhl U, Hasenclever D, Nisters-Backes H, Sieber M, Tesch H, Franklin J, Geilen W, Bartels H, Cartoni C, Dolken G, Enzian J, Fuchs R, Gassmann W, Gerhartz H, Hagen-Aukamp U, Hiller E, Hinkelbein H, Hinterberger W, Kirchner H, Koch P, Kruger B, Schwarze EW, et al
Dose-response relationship of complementary radiotherapy following four cycles of combination chemotherapy in intermediate-stage Hodgkin's disease.
J Clin Oncol 1997 Jun;15(6):2275-87
PMID: 9196141
Fontao L, Stutzmann J, Gendry P, Launay JF
Regulation of the type II hemidesmosomal plaque assembly in intestinal epithelial cells.
Exp Cell Res 1999 Aug 1;250(2):298-312
PMID: 10413585
Yang X, Jia L, Wei L, Zuo W, Song S
[Correlation of expression levels of multidrug resistance gene 1 (mdr1) mRNA, multidrug resistance-associated protein (MRP), amd P-glycoprotein (P-gp) with chemotherapy efficacy in malignant lymphomas]
Zhonghua Yi Xue Za Zhi 2002 Sep 10;82(17):1177-9
PMID: 12475404
Kaufman G
Investigating the nursing contribution to commissioning in primary health-care.
J Nurs Manag 2002 Mar;10(2):83-94
PMID: 11882109
Schroder R, Mundegar RR, Treusch M, Schlegel U, Blumcke I, Owaribe K, Magin TM
Altered distribution of plectin/HD1 in dystrophinopathies.
Eur J Cell Biol 1997 Oct;74(2):165-71
PMID: 9352221
Hormia M, Owaribe K, Virtanen I
The dento-epithelial junction: cell adhesion by type I hemidesmosomes in the absence of a true basal lamina.
J Periodontol 2001 Jun;72(6):788-97
PMID: 11453242
Glider P, Midyett SJ, Mills-Novoa B, Johannessen K, Collins C
Challenging the collegiate rite of passage: a campus-wide social marketing media campaign to reduce binge drinking.
J Drug Educ 2001;31(2):207-20
PMID: 11487995
Deshpande V, Venkatesh SG
Thyroglobulin, the prothyroid hormone: chemistry, synthesis and degradation.
Biochim Biophys Acta 1999 Mar 19;1430(2):157-78
PMID: 10082945
De Cristofaro R, De Candia E, Rutella S, Weitz JI
The Asp(272)-Glu(282) region of platelet glycoprotein Ibalpha interacts with the heparin-binding site of alpha-thrombin and protects the enzyme from the heparin-catalyzed inhibition by antithrombin III.
J Biol Chem 2000 Feb 11;275(6):3887-95
PMID: 10660541
Leivo T, Kiistala U, Vesterinen M, Owaribe K, Burgeson RE, Virtanen I, Oikarinen A
Re-epithelialization rate and protein expression in the suction-induced wound model: comparison between intact blisters, open wounds and calcipotriol-pretreated open wounds.
Br J Dermatol 2000 May;142(5):991-1002
PMID: 10809861
Liddle HA, Hogue A
A family-based, developmental-ecological preventive intervention for high-risk adolescents.
J Marital Fam Ther 2000 Jul;26(3):265-79
PMID: 10934674
Homan SM, Mercurio AM, LaFlamme SE
Endothelial cells assemble two distinct alpha6beta4-containing vimentin-associated structures: roles for ligand binding and the beta4 cytoplasmic tail.
J Cell Sci 1998 Sep;111 ( Pt 18):2717-28
PMID: 9718365
Schaapveld RQ, Borradori L, Geerts D, van Leusden MR, Kuikman I, Nievers MG, Niessen CM, Steenbergen RD, Snijders PJ, Sonnenberg A
Hemidesmosome formation is initiated by the beta4 integrin subunit, requires complex formation of beta4 and HD1/plectin, and involves a direct interaction between beta4 and the bullous pemphigoid antigen 180.
J Cell Biol 1998 Jul 13;142(1):271-84
PMID: 9660880
Flechtner H, Ruffer JU, Henry-Amar M, Mellink WA, Sieber M, Ferme C, Eghbali H, Josting A, Diehl V
Quality of life assessment in Hodgkin's disease: a new comprehensive approach. First experiences from the EORTC/GELA and GHSG trials. EORTC Lymphoma Cooperative Group. Groupe D'Etude des Lymphomes de L'Adulte and German Hodgkin Study Group.
Ann Oncol 1998;9 Suppl 5:S147-54
PMID: 9926255
Proby C, Fujii Y, Owaribe K, Nishikawa T, Amagai M
Human autoantibodies against HD1/plectin in paraneoplastic pemphigus.
J Invest Dermatol 1999 Feb;112(2):153-6
PMID: 9989789
Shimizu H, Masunaga T, Kurihara Y, Owaribe K, Wiche G, Pulkkinen L, Uitto J, Nishikawa T
Expression of plectin and HD1 epitopes in patients with epidermolysis bullosa simplex associated with muscular dystrophy.
Arch Dermatol Res 1999 Oct;291(10):531-7
PMID: 10552210
Kurose K, Mori O, Hachisuka H, Shimizu H, Owaribe K, Hashimoto T
Cultured keratinocytes from plectin/HD1-deficient epidermolysis bullosa simplex showed altered ability of adhesion to the matrix.
J Dermatol Sci 2000 Dec;24(3):184-9
PMID: 11084300
Nievers MG, Kuikman I, Geerts D, Leigh IM, Sonnenberg A
Formation of hemidesmosome-like structures in the absence of ligand binding by the (alpha)6(beta)4 integrin requires binding of HD1/plectin to the cytoplasmic domain of the (beta)4 integrin subunit.
J Cell Sci 2000 Mar;113 ( Pt 6):963-73
PMID: 10683145
Hirako Y, Owaribe K
Hemidesmosomes and their unique transmembrane protein BP180.
Microsc Res Tech 1998 Nov 1;43(3):207-17
PMID: 9840798
Borradori L, Chavanas S, Schaapveld RQ, Gagnoux-Palacios L, Calafat J, Meneguzzi G, Sonnenberg A
Role of the bullous pemphigoid antigen 180 (BP180) in the assembly of hemidesmosomes and cell adhesion--reexpression of BP180 in generalized atrophic benign epidermolysis bullosa keratinocytes.
Exp Cell Res 1998 Mar 15;239(2):463-76
PMID: 9521865
Alland L, Muhle R, Hou H Jr, Potes J, Chin L, Schreiber-Agus N, DePinho RA
Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression.
Nature 1997 May 1;387(6628):49-55
PMID: 9139821
Levavi-Sivan B, Park BH, Fuchs S, Fishburn CS
Human D3 dopamine receptor in the medulloblastoma TE671 cell line: cross-talk between D1 and D3 receptors.
FEBS Lett 1998 Nov 13;439(1-2):138-42
PMID: 9849894
Niessen CM, Hulsman EH, Oomen LC, Kuikman I, Sonnenberg A
A minimal region on the integrin beta4 subunit that is critical to its localization in hemidesmosomes regulates the distribution of HD1/plectin in COS-7 cells.
J Cell Sci 1997 Aug;110 ( Pt 15):1705-16
PMID: 9264458
Jenster G, Spencer TE, Burcin MM, Tsai SY, Tsai MJ, O'Malley BW
Steroid receptor induction of gene transcription: a two-step model.
Proc Natl Acad Sci U S A 1997 Jul 22;94(15):7879-84
PMID: 9223281
Niessen CM, Hulsman EH, Rots ES, Sanchez-Aparicio P, Sonnenberg A
Integrin alpha 6 beta 4 forms a complex with the cytoskeletal protein HD1 and induces its redistribution in transfected COS-7 cells.
Mol Biol Cell 1997 Apr;8(4):555-66
PMID: 9247637
Kassack MU, Hofgen B, Lehmann J, Eckstein N, Quillan JM, Sadee W
Functional screening of G protein-coupled receptors by measuring intracellular calcium with a fluorescence microplate reader.
J Biomol Screen 2002 Jun;7(3):233-46
PMID: 12097186
Valadares De Amorim G, Whittome B, Shore B, Levin DB
Identification of Bacillus thuringiensis subsp. kurstaki strain HD1-Like bacteria from environmental and human samples after aerial spraying of Victoria, British Columbia, Canada, with Foray 48B.
Appl Environ Microbiol 2001 Mar;67(3):1035-43
PMID: 11229889
Rahman MO, Liu J
Gender differences in functioning for older adults in rural Bangladesh. The impact of differential reporting?
J Gerontol A Biol Sci Med Sci 2000 Jan;55(1):M28-33
PMID: 10719770
Leivo T, Lohi J, Kariniemi AL, Molander G, Kiraly CL, Kotovirta ML, Owaribe K, Burgeson RE, Leivo I
Hemidesmosomal molecular changes in dermatitis herpetiformis; decreased expression of BP230 and plectin/HD1 in uninvolved skin.
Histochem J 1999 Feb;31(2):109-16
PMID: 10416682
Lohi J, Leivo I, Owaribe K, Burgeson RE, Franssila K, Virtanen I
Neoexpression of the epithelial adhesion complex antigens in thyroid tumours is associated with proliferation and squamous differentiation markers.
J Pathol 1998 Feb;184(2):191-6
PMID: 9602711
Langdridge D
The welfare of the child: problems of indeterminacy and deontology.
Hum Reprod 2000 Mar;15(3):502-4
PMID: 10686186
Sieradzan KA, Mechan AO, Jones L, Wanker EE, Nukina N, Mann DM
Huntington's disease intranuclear inclusions contain truncated, ubiquitinated huntingtin protein.
Exp Neurol 1999 Mar;156(1):92-9
PMID: 10192780
Dellambra E, Prislei S, Salvati AL, Madeddu ML, Golisano O, Siviero E, Bondanza S, Cicuzza S, Orecchia A, Giancotti FG, Zambruno G, De Luca M
Gene correction of integrin beta4-dependent pyloric atresia-junctional epidermolysis bullosa keratinocytes establishes a role for beta4 tyrosines 1422 and 1440 in hemidesmosome assembly.
J Biol Chem 2001 Nov 2;276(44):41336-42
PMID: 11522777
Gagnoux-Palacios L, Gache Y, Ortonne JP, Meneguzzi G
Hemidesmosome assembly assessed by expression of a wild-type integrin beta 4 cDNA in junctional epidermolysis bullosa keratinocytes.
Lab Invest 1997 Nov;77(5):459-68
PMID: 9389789
Shimizu H, Horiguchi Y, Suzumori K, Watanabe I, Owaribe K, Nishikawa T
Successful prenatal exclusion of an unspecified subtype of severe epidermolysis bullosa.
Int J Dermatol 1998 May;37(5):364-9
PMID: 9620484
Millan MJ, Newman-Tancredi A, Brocco M, Gobert A, Lejeune F, Audinot V, Rivet JM, Schreiber R, Dekeyne A, Spedding M, Nicolas JP, Peglion JL
S 18126 ([2-[4-(2,3-dihydrobenzo[1,4]dioxin-6-yl)piperazin-1-yl methyl]indan-2-yl]), a potent, selective and competitive antagonist at dopamine D4 receptors: an in vitro and in vivo comparison with L 745,870 (3-(4-[4-chlorophenyl]piperazin-1-yl)methyl-1H-pyrrolo[2, 3b]pyridine) and raclopride.
J Pharmacol Exp Ther 1998 Oct;287(1):167-86
PMID: 9765336
Hirako Y, Owaribe K
[Molecular architecture of hemidesmosomes and desmosomes]
Seikagaku 1999 Dec;71(12):1417-31
PMID: 10659676
Audinot V, Newman-Tancredi A, Gobert A, Rivet JM, Brocco M, Lejeune F, Gluck L, Desposte I, Bervoets K, Dekeyne A, Millan MJ
A comparative in vitro and in vivo pharmacological characterization of the novel dopamine D3 receptor antagonists (+)-S 14297, nafadotride, GR 103,691 and U 99194.
J Pharmacol Exp Ther 1998 Oct;287(1):187-97
PMID: 9765337
Nicholl AJ, Killey J, Leonard MN, Garner C
The role of bicarbonate in regulatory volume decrease (RVD) in the epithelial-derived human breast cancer cell line ZR-75-1.
Pflugers Arch 2002 Mar;443(5-6):875-81
PMID: 11889588
Zhang ZK, Davies KP, Allen J, Zhu L, Pestell RG, Zagzag D, Kalpana GV
Cell cycle arrest and repression of cyclin D1 transcription by INI1/hSNF5.
Mol Cell Biol 2002 Aug;22(16):5975-88
PMID: 12138206
Vietor I, Vadivelu SK, Wick N, Hoffman R, Cotten M, Seiser C, Fialka I, Wunderlich W, Haase A, Korinkova G, Brosch G, Huber LA
TIS7 interacts with the mammalian SIN3 histone deacetylase complex in epithelial cells.
EMBO J 2002 Sep 2;21(17):4621-31
PMID: 12198164
Kirsh O, Seeler JS, Pichler A, Gast A, Muller S, Miska E, Mathieu M, Harel-Bellan A, Kouzarides T, Melchior F, Dejean A
The SUMO E3 ligase RanBP2 promotes modification of the HDAC4 deacetylase.
EMBO J 2002 Jun 3;21(11):2682-91
PMID: 12032081
Hoogeveen AT, Rossetti S, Stoyanova V, Schonkeren J, Fenaroli A, Schiaffonati L, van Unen L, Sacchi N
The transcriptional corepressor MTG16a contains a novel nucleolar targeting sequence deranged in t (16; 21)-positive myeloid malignancies.
Oncogene 2002 Sep 26;21(43):6703-12
PMID: 12242670
Furumai R, Matsuyama A, Kobashi N, Lee KH, Nishiyama M, Nakajima H, Tanaka A, Komatsu Y, Nishino N, Yoshida M, Horinouchi S
FK228 (depsipeptide) as a natural prodrug that inhibits class I histone deacetylases.
Cancer Res 2002 Sep 1;62(17):4916-21
PMID: 12208741
Bandyopadhyay D, Okan NA, Bales E, Nascimento L, Cole PA, Medrano EE
Down-regulation of p300/CBP histone acetyltransferase activates a senescence checkpoint in human melanocytes.
Cancer Res 2002 Nov 1;62(21):6231-9
PMID: 12414652
Milutinovic S, Zhuang Q, Szyf M
Proliferating cell nuclear antigen associates with histone deacetylase activity, integrating DNA replication and chromatin modification.
J Biol Chem 2002 Jun 7;277(23):20974-8
PMID: 11929879
Melnick A, Carlile G, Ahmad KF, Kiang CL, Corcoran C, Bardwell V, Prive GG, Licht JD
Critical residues within the BTB domain of PLZF and Bcl-6 modulate interaction with corepressors.
Mol Cell Biol 2002 Mar;22(6):1804-18
PMID: 11865059
Senyuk V, Chakraborty S, Mikhail FM, Zhao R, Chi Y, Nucifora G
The leukemia-associated transcription repressor AML1/MDS1/EVI1 requires CtBP to induce abnormal growth and differentiation of murine hematopoietic cells.
Oncogene 2002 May 9;21(20):3232-40
PMID: 12082639
Galasinski SC, Resing KA, Goodrich JA, Ahn NG
Phosphatase inhibition leads to histone deacetylases 1 and 2 phosphorylation and disruption of corepressor interactions.
J Biol Chem 2002 May 31;277(22):19618-26
PMID: 11919195
Valimaki S, Forsberg L, Farnebo LO, Larsson C
Distinct target regions for chromosome 1p deletions in parathyroid adenomas and carcinomas.
Int J Oncol 2002 Oct;21(4):727-35
PMID: 12239610
Kuzmichev A, Nishioka K, Erdjument-Bromage H, Tempst P, Reinberg D
Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein.
Genes Dev 2002 Nov 15;16(22):2893-905
PMID: 12435631
Tsai SC, Seto E
Regulation of histone deacetylase 2 by protein kinase CK2.
J Biol Chem 2002 Aug 30;277(35):31826-33
PMID: 12082111
Ecsedy JA, Michaelson JS, Leder P
Homeodomain-interacting protein kinase 1 modulates Daxx localization, phosphorylation, and transcriptional activity.
Mol Cell Biol 2003 Feb;23(3):950-60
PMID: 12529400
Gaughan L, Logan IR, Cook S, Neal DE, Robson CN
Tip60 and histone deacetylase 1 regulate androgen receptor activity through changes to the acetylation status of the receptor.
J Biol Chem 2002 Jul 19;277(29):25904-13
PMID: 11994312
Ding Z, Gillespie LL, Paterno GD
Human MI-ER1 alpha and beta function as transcriptional repressors by recruitment of histone deacetylase 1 to their conserved ELM2 domain.
Mol Cell Biol 2003 Jan;23(1):250-8
PMID: 12482978
Ozawa Y
[Histone deacetylase-targeted anti-leukemia therapy]
Rinsho Ketsueki 2002 Apr;43(4):231-4
PMID: 12043197
Ito K, Caramori G, Lim S, Oates T, Chung KF, Barnes PJ, Adcock IM
Expression and activity of histone deacetylases in human asthmatic airways.
Am J Respir Crit Care Med 2002 Aug 1;166(3):392-6
PMID: 12153977
Saito M, Ishikawa F
The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.
J Biol Chem 2002 Sep 20;277(38):35434-9
PMID: 12124384
Wang S, Fusaro G, Padmanabhan J, Chellappan SP
Prohibitin co-localizes with Rb in the nucleus and recruits N-CoR and HDAC1 for transcriptional repression.
Oncogene 2002 Dec 5;21(55):8388-96
PMID: 12466959
Yamagoe S, Kanno T, Kanno Y, Sasaki S, Siegel RM, Lenardo MJ, Humphrey G, Wang Y, Nakatani Y, Howard BH, Ozato K
Interaction of histone acetylases and deacetylases in vivo.
Mol Cell Biol 2003 Feb;23(3):1025-33
PMID: 12529406
Anderson LA, Perkins ND
The large subunit of replication factor C interacts with the histone deacetylase, HDAC1.
J Biol Chem 2002 Aug 16;277(33):29550-4
PMID: 12045192
Choi HS, Lee JH, Park JG, Lee YI
Trichostatin A, a histone deacetylase inhibitor, activates the IGFBP-3 promoter by upregulating Sp1 activity in hepatoma cells: alteration of the Sp1/Sp3/HDAC1 multiprotein complex.
Biochem Biophys Res Commun 2002 Aug 30;296(4):1005-12
PMID: 12200149
Fu M, Wang C, Wang J, Zhang X, Sakamaki T, Yeung YG, Chang C, Hopp T, Fuqua SA, Jaffray E, Hay RT, Palvimo JJ, Janne OA, Pestell RG
Androgen receptor acetylation governs trans activation and MEKK1-induced apoptosis without affecting in vitro sumoylation and trans-repression function.
Mol Cell Biol 2002 May;22(10):3373-88
PMID: 11971970
Chiocca S, Kurtev V, Colombo R, Boggio R, Sciurpi MT, Brosch G, Seiser C, Draetta GF, Cotten M
Histone deacetylase 1 inactivation by an adenovirus early gene product.
Curr Biol 2002 Apr 2;12(7):594-8
PMID: 11937030
Sakai H, Urano T, Ookata K, Kim MH, Hirai Y, Saito M, Nojima Y, Ishikawa F
MBD3 and HDAC1, two components of the NuRD complex, are localized at Aurora-A-positive centrosomes in M phase.
J Biol Chem 2002 Dec 13;277(50):48714-23
PMID: 12354758
He G, Margolis DM
Counterregulation of chromatin deacetylation and histone deacetylase occupancy at the integrated promoter of human immunodeficiency virus type 1 (HIV-1) by the HIV-1 repressor YY1 and HIV-1 activator Tat.
Mol Cell Biol 2002 May;22(9):2965-73
PMID: 11940654
Singh J, Murata K, Itahana Y, Desprez PY
Constitutive expression of the Id-1 promoter in human metastatic breast cancer cells is linked with the loss of NF-1/Rb/HDAC-1 transcription repressor complex.
Oncogene 2002 Mar 14;21(12):1812-22
PMID: 11896613
Yang L, Mei Q, Zielinska-Kwiatkowska A, Matsui Y, Blackburn ML, Benedetti D, Krumm AA, Taborsky GJ Jr, Chansky HA
An ERG (ets-related gene)-associated histone methyltransferase interacts with histone deacetylases 1/2 and transcription co-repressors mSin3A/B.
Biochem J 2003 Feb 1;369(Pt 3):651-7
PMID: 12398767
Vieyra D, Loewith R, Scott M, Bonnefin P, Boisvert FM, Cheema P, Pastyryeva S, Meijer M, Johnston RN, Bazett-Jones DP, McMahon S, Cole MD, Young D, Riabowol K
Human ING1 proteins differentially regulate histone acetylation.
J Biol Chem 2002 Aug 16;277(33):29832-9
PMID: 12015309
Gavva NR, Wen SC, Daftari P, Moniwa M, Yang WM, Yang-Feng LP, Seto E, Davie JR, Shen CK
NAPP2, a peroxisomal membrane protein, is also a transcriptional corepressor.
Genomics 2002 Mar;79(3):423-31
PMID: 11863372
Zhang Y, Dufau ML
Silencing of transcription of the human luteinizing hormone receptor gene by histone deacetylase-mSin3A complex.
J Biol Chem 2002 Sep 6;277(36):33431-8
PMID: 12091390
Zhong H, May MJ, Jimi E, Ghosh S
The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1.
Mol Cell 2002 Mar;9(3):625-36
PMID: 11931769
Aapola U, Liiv I, Peterson P
Imprinting regulator DNMT3L is a transcriptional repressor associated with histone deacetylase activity.
Nucleic Acids Res 2002 Aug 15;30(16):3602-8
PMID: 12177302
Travers H, Spotswood HT, Moss PA, Turner BM
Human CD34+ hematopoietic progenitor cells hyperacetylate core histones in response to sodium butyrate, but not trichostatin A.
Exp Cell Res 2002 Nov 1;280(2):149-58
PMID: 12413881
Lin HM, Zhao L, Cheng SY
Cyclin D1 Is a Ligand-independent Co-repressor for Thyroid Hormone Receptors.
J Biol Chem 2002 Aug 9;277(32):28733-41
PMID: 12048199
Ego T, Ariumi Y, Shimotohno K
The interaction of HTLV-1 Tax with HDAC1 negatively regulates the viral gene expression.
Oncogene 2002 Oct 17;21(47):7241-6
PMID: 12370815
Demirpence E, Semlali A, Oliva J, Balaguer P, Badia E, Duchesne MJ, Nicolas JC, Pons M
An estrogen-responsive element-targeted histone deacetylase enzyme has an antiestrogen activity that differs from that of hydroxytamoxifen.
Cancer Res 2002 Nov 15;62(22):6519-28
PMID: 12438246
Ito A, Kawaguchi Y, Lai CH, Kovacs JJ, Higashimoto Y, Appella E, Yao TP
MDM2-HDAC1-mediated deacetylation of p53 is required for its degradation.
EMBO J 2002 Nov 15;21(22):6236-45
PMID: 12426395
Deplus R, Brenner C, Burgers WA, Putmans P, Kouzarides T, de Launoit Y, Fuks F
Dnmt3L is a transcriptional repressor that recruits histone deacetylase.
Nucleic Acids Res 2002 Sep 1;30(17):3831-8
PMID: 12202768
Graff RJ, Kurtz ME, Paul R, Martin D, Roopenian DC
Additional mapping of mouse chromosome 2 genes.
Immunogenetics 1991;33(2):96-100
PMID: 1999355
Teruya-Feldstein J, Tosato G, Jaffe ES
The role of chemokines in Hodgkin's disease.
Leuk Lymphoma 2000 Jul;38(3-4):363-71
PMID: 10830743
Fausser JL, Schlepp O, Aberdam D, Meneguzzi G, Ruch JV, Lesot H
Localization of antigens associated with adherens junctions, desmosomes, and hemidesmosomes during murine molar morphogenesis.
Differentiation 1998 May;63(1):1-11
PMID: 9615388
Paria BC, Song H, Wang X, Schmid PC, Krebsbach RJ, Schmid HH, Bonner TI, Zimmer A, Dey SK
Dysregulated cannabinoid signaling disrupts uterine receptivity for embryo implantation.
J Biol Chem 2001 Jun 8;276(23):20523-8
PMID: 11279117
Pulkkinen L, Smith FJ, Shimizu H, Murata S, Yaoita H, Hachisuka H, Nishikawa T, McLean WH, Uitto J
Homozygous deletion mutations in the plectin gene (PLEC1) in patients with epidermolysis bullosa simplex associated with late-onset muscular dystrophy.
Hum Mol Genet 1996 Oct;5(10):1539-46
PMID: 8894687
Graff RJ, Hauptfeld V, Riordan K, Kurtz M
Continued mapping of chromosome 2 genes.
Immunogenetics 1994;40(1):21-6
PMID: 8206522
Chiarle R, Podda A, Prolla G, Gong J, Thorbecke GJ, Inghirami G
CD30 in normal and neoplastic cells.
Clin Immunol 1999 Feb;90(2):157-64
PMID: 10080826
Manna PR, Kero J, Tena-Sempere M, Pakarinen P, Stocco DM, Huhtaniemi IT
Assessment of mechanisms of thyroid hormone action in mouse Leydig cells: regulation of the steroidogenic acute regulatory protein, steroidogenesis, and luteinizing hormone receptor function.
Endocrinology 2001 Jan;142(1):319-31
PMID: 11145595
Pereira L, Klassen T, Baringer JR
Type-common and type-specific monoclonal antibody to herpes simplex virus type 1.
Infect Immun 1980 Aug;29(2):724-32
PMID: 6260657
Knudsen PJ, Strominger JL
A monoclonal antibody that recognizes the alpha chain of HLA-DR antigens.
Hum Immunol 1986 Feb;15(2):150-63
PMID: 3005199
Durcan MJ, Morgan PF
Hypothermic effects of alkylxanthines: evidence for a calcium-independent phosphodiesterase action.
Eur J Pharmacol 1991 Oct 29;204(1):15-20
PMID: 1804662
Kolle D, Brosch G, Lechner T, Pipal A, Helliger W, Taplick J, Loidl P
Different types of maize histone deacetylases are distinguished by a highly complex substrate and site specificity.
Biochemistry 1999 May 25;38(21):6769-73
PMID: 10346897
Mai A, Massa S, Ragno R, Esposito M, Sbardella G, Nocca G, Scatena R, Jesacher F, Loidl P, Brosch G
Binding mode analysis of 3-(4-benzoyl-1-methyl-1H-2-pyrrolyl)-N-hydroxy-2-propenamide: a new synthetic histone deacetylase inhibitor inducing histone hyperacetylation, growth inhibition, and terminal cell differentiation.
J Med Chem 2002 Apr 25;45(9):1778-84
PMID: 11960489
Yun YS, Goldberger G, Minta JO
Cloning and characterization of the non-catalytic heavy chain of mouse complement factor I gene: structure comparison with the human homologue.
Biochem Mol Biol Int 1999 Mar;47(3):493-500
PMID: 10204086
Seabrook GR, McAllister G, Knowles MR, Myers J, Sinclair H, Patel S, Freedman SB, Kemp JA
Depression of high-threshold calcium currents by activation of human D2 (short) dopamine receptors expressed in differentiated NG108-15 cells.
Br J Pharmacol 1994 Apr;111(4):1061-6
PMID: 8032591
Mai A, Massa S, Ragno R, Cerbara I, Jesacher F, Loidl P, Brosch G
3-(4-Aroyl-1-methyl-1H-2-pyrrolyl)-N-hydroxy-2-alkylamides as a new class of synthetic histone deacetylase inhibitors. 1. Design, synthesis, biological evaluation, and binding mode studies performed through three different docking procedures.
J Med Chem 2003 Feb 13;46(4):512-24
PMID: 12570373
Jou YS, Myers RM
Evidence from antibody studies that the CAG repeat in the Huntington disease gene is expressed in the protein.
Hum Mol Genet 1995 Mar;4(3):465-9
PMID: 7795604
Yu F, Thiesen J, Stratling WH
Histone deacetylase-independent transcriptional repression by methyl-CpG-binding protein 2.
Nucleic Acids Res 2000 May 15;28(10):2201-6
PMID: 10773092
Yu Z, Zhang W, Kone BC
Histone deacetylases augment cytokine induction of the iNOS gene.
J Am Soc Nephrol 2002 Aug;13(8):2009-17
PMID: 12138131
Kiefer SM, McDill BW, Yang J, Rauchman M
Murine Sall1 represses transcription by recruiting a histone deacetylase complex.
J Biol Chem 2002 Apr 26;277(17):14869-76
PMID: 11836251
Zhang CL, McKinsey TA, Chang S, Antos CL, Hill JA, Olson EN
Class II histone deacetylases act as signal-responsive repressors of cardiac hypertrophy.
Cell 2002 Aug 23;110(4):479-88
PMID: 12202037
Zeng Y, Tang CM, Yao YL, Yang WM, Seto E
Cloning and characterization of the mouse histone deacetylase-2 gene.
J Biol Chem 1998 Oct 30;273(44):28921-30
PMID: 9786895
Ahmad A, Takami Y, Nakayama T
WD repeats of the p48 subunit of chicken chromatin assembly factor-1 required for in vitro interaction with chicken histone deacetylase-2.
J Biol Chem 1999 Jun 4;274(23):16646-53
PMID: 10347232
Nicolas E, Ait-Si-Ali S, Trouche D
The histone deacetylase HDAC3 targets RbAp48 to the retinoblastoma protein.
Nucleic Acids Res 2001 Aug 1;29(15):3131-6
PMID: 11470869
David G, Neptune MA, DePinho RA
SUMO-1 modification of histone deacetylase 1 (HDAC1) modulates its biological activities.
J Biol Chem 2002 Jun 28;277(26):23658-63
PMID: 11960997
Lagger G, O'Carroll D, Rembold M, Khier H, Tischler J, Weitzer G, Schuettengruber B, Hauser C, Brunmeir R, Jenuwein T, Seiser C
Essential function of histone deacetylase 1 in proliferation control and CDK inhibitor repression.
EMBO J 2002 Jun 3;21(11):2672-81
PMID: 12032080
Eder IE, Hoffmann J, Rogatsch H, Schafer G, Zopf D, Bartsch G, Klocker H
Inhibition of LNCaP prostate tumor growth in vivo by an antisense oligonucleotide directed against the human androgen receptor.
Cancer Gene Ther 2002 Feb;9(2):117-25
PMID: 11857028
Taplick J, Kurtev V, Kroboth K, Posch M, Lechner T, Seiser C
Homo-oligomerisation and nuclear localisation of mouse histone deacetylase 1.
J Mol Biol 2001 Apr 20;308(1):27-38
PMID: 11302704
Takechi S, Adachi M, Nakayama T
Chicken HDAC2 down-regulates IgM light chain gene promoter activity.
Biochem Biophys Res Commun 2002 Nov 29;299(2):263-7
PMID: 12437980
Hollenbach AD, McPherson CJ, Mientjes EJ, Iyengar R, Grosveld G
Daxx and histone deacetylase II associate with chromatin through an interaction with core histones and the chromatin-associated protein Dek.
J Cell Sci 2002 Aug 15;115(Pt 16):3319-30
PMID: 12140263
Khier H, Bartl S, Schuettengruber B, Seiser C
Molecular cloning and characterization of the mouse histone deacetylase 1 gene: integration of a retrovirus in 129SV mice.
Biochim Biophys Acta 1999 Dec 23;1489(2-3):365-73
PMID: 10673037
Rountree MR, Bachman KE, Baylin SB
DNMT1 binds HDAC2 and a new co-repressor, DMAP1, to form a complex at replication foci.
Nat Genet 2000 Jul;25(3):269-77
PMID: 10888872
Ballas N, Battaglioli E, Atouf F, Andres ME, Chenoweth J, Anderson ME, Burger C, Moniwa M, Davie JR, Bowers WJ, Federoff HJ, Rose DW, Rosenfeld MG, Brehm P, Mandel G
Regulation of neuronal traits by a novel transcriptional complex.
Neuron 2001 Aug 16;31(3):353-65
PMID: 11516394
Laherty CD, Billin AN, Lavinsky RM, Yochum GS, Bush AC, Sun JM, Mullen TM, Davie JR, Rose DW, Glass CK, Rosenfeld MG, Ayer DE, Eisenman RN
SAP30, a component of the mSin3 corepressor complex involved in N-CoR-mediated repression by specific transcription factors.
Mol Cell 1998 Jul;2(1):33-42
PMID: 9702189
Ashburner BP, Westerheide SD, Baldwin AS Jr
The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression.
Mol Cell Biol 2001 Oct;21(20):7065-77
PMID: 11564889
Shi Y, Downes M, Xie W, Kao HY, Ordentlich P, Tsai CC, Hon M, Evans RM
Sharp, an inducible cofactor that integrates nuclear receptor repression and activation.
Genes Dev 2001 May 1;15(9):1140-51
PMID: 11331609
Takebayashi S, Nakao M, Fujita N, Sado T, Tanaka M, Taguchi H, Okumura K
5-Aza-2'-deoxycytidine induces histone hyperacetylation of mouse centromeric heterochromatin by a mechanism independent of DNA demethylation.
Biochem Biophys Res Commun 2001 Nov 9;288(4):921-6
PMID: 11688997
Vannier D, Balderes D, Shore D
Evidence that the transcriptional regulators SIN3 and RPD3, and a novel gene (SDS3) with similar functions, are involved in transcriptional silencing in S. cerevisiae.
Genetics 1996 Dec;144(4):1343-53
PMID: 8978024
Stillman DJ, Dorland S, Yu Y
Epistasis analysis of suppressor mutations that allow HO expression in the absence of the yeast SW15 transcriptional activator.
Genetics 1994 Mar;136(3):781-8
PMID: 8005433
Nasmyth K, Stillman D, Kipling D
Both positive and negative regulators of HO transcription are required for mother-cell-specific mating-type switching in yeast.
Cell 1987 Feb 27;48(4):579-87
PMID: 3028642
Dora EG, Rudin N, Martell JR, Esposito MS, Ramirez RM
RPD3 (REC3) mutations affect mitotic recombination in Saccharomyces cerevisiae.
Curr Genet 1999 Mar;35(2):68-76
PMID: 10079324
Esposito MS, Brown JT
Conditional hyporecombination mutants of three REC genes of Saccharomyces cerevisiae.
Curr Genet 1990 Jan;17(1):7-12
PMID: 2178786
Roopra A, Sharling L, Wood IC, Briggs T, Bachfischer U, Paquette AJ, Buckley NJ
Transcriptional repression by neuron-restrictive silencer factor is mediated via the Sin3-histone deacetylase complex.
Mol Cell Biol 2000 Mar;20(6):2147-57
PMID: 10688661
Elkhaimi M, Kaadige MR, Kamath D, Jackson JC, Biliran H Jr, Lopes JM
Combinatorial regulation of phospholipid biosynthetic gene expression by the UME6, SIN3 and RPD3 genes.
Nucleic Acids Res 2000 Aug 15;28(16):3160-7
PMID: 10931932
Vannier D, Damay P, Shore D
A role for Sds3p, a component of the Rpd3p/Sin3p deacetylase complex, in maintaining cellular integrity in Saccharomyces cerevisiae.
Mol Genet Genomics 2001 May;265(3):560-8
PMID: 11405640
Kasten MM, Dorland S, Stillman DJ
A large protein complex containing the yeast Sin3p and Rpd3p transcriptional regulators.
Mol Cell Biol 1997 Aug;17(8):4852-8
PMID: 9234741
Lamb TM, Mitchell AP
Coupling of Saccharomyces cerevisiae early meiotic gene expression to DNA replication depends upon RPD3 and SIN3.
Genetics 2001 Feb;157(2):545-56
PMID: 11156977
Hepworth SR, Friesen H, Segall J
NDT80 and the meiotic recombination checkpoint regulate expression of middle sporulation-specific genes in Saccharomyces cerevisiae.
Mol Cell Biol 1998 Oct;18(10):5750-61
PMID: 9742092
Meskauskas A, Baxter JL, Carr EA, Yasenchak J, Gallagher JE, Baserga SJ, Dinman JD
Delayed rRNA processing results in significant ribosome biogenesis and functional defects.
Mol Cell Biol 2003 Mar;23(5):1602-13
PMID: 12588980
Lamping E, Luckl J, Paltauf F, Henry SA, Kohlwein SD
Isolation and characterization of a mutant of Saccharomyces cerevisiae with pleiotropic deficiencies in transcriptional activation and repression.
Genetics 1994 May;137(1):55-65
PMID: 8056324
Krebs JE, Kuo MH, Allis CD, Peterson CL
Cell cycle-regulated histone acetylation required for expression of the yeast HO gene.
Genes Dev 1999 Jun 1;13(11):1412-21
PMID: 10364158
Jiang JC, Wawryn J, Shantha Kumara HM, Jazwinski SM
Distinct roles of processes modulated by histone deacetylases Rpd3p, Hda1p, and Sir2p in life extension by caloric restriction in yeast.
Exp Gerontol 2002 Aug-Sep;37(8-9):1023-30
PMID: 12213553
Bernstein BE, Tong JK, Schreiber SL
Genomewide studies of histone deacetylase function in yeast.
Proc Natl Acad Sci U S A 2000 Dec 5;97(25):13708-13
PMID: 11095743

Options:

Limit of E-value: 1e-20
Limit of Length: 100000
Limit of references returned each search: 40
Limit of retry times: 3
Direct references: Yes
Indirect references: Yes
Allow symbol with hyphen: Yes
Use stop word list: Yes
Thesaurus:
- Mus musculus (Version: 20021209.0)
- Homo sapiens (Version: 20021206.0)
- Saccharomyces cerevisiae (Version: 20021123.0)




 
BLASTN 2.2.5 [Nov-16-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
RID: 1048253089-018769-16310
Query= ORFN:YGL194C HOS2 SGDID:S0003162, Chr VII from 140372-141730,
reverse complement
         (1359 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences) 
           1,707,549 sequences; 7,931,913,529 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|1322818|emb|Z72716.1|SCYGL194C S.cerevisiae chromosome VII re...  2208   0.0  
gi|1177627|emb|X91837.1|SCCHVIIEU S.cerevisiae G1301, G1304, G13...  2179   0.0  
gi|773397|emb|X78454.1|XLAB21 X.laevis AB21 mRNA for RPD3 homologue    50   0.009
gi|27735465|gb|BC041296.1| Xenopus laevis, Similar to histone de...    48   0.036
gi|1301708|emb|Z72513.1|CET04F3 Caenorhabditis elegans cosmid T0...    48   0.036
gi|2444429|gb|AF020658.1|AF020658 Xenopus laevis deacetylase (RP...    48   0.036
gi|18921228|gb|AC078952.20| Homo sapiens 3 BAC RP11-764E15 (Rosw...    46   0.14 
gi|6680194|ref|NM_008229.1| Mus musculus histone deacetylase 2 (...    46   0.14 
gi|11386269|gb|AC008462.6|AC008462 Homo sapiens chromosome 5 clo...    46   0.14 
gi|10716829|gb|AF139991.1|AF139991 Cryptosporidium parvum histon...    46   0.14 
gi|26342185|dbj|AK051753.1| Mus musculus 12 days embryo spinal g...    46   0.14 
gi|2791685|gb|AF039752.1|AF039752 Gallus gallus histone deacetyl...    46   0.14 
gi|1667395|gb|U31758.1|MMU31758 Mus musculus transcriptional reg...    46   0.14 
gi|18042519|gb|AC080166.6| Homo sapiens BAC clone RP11-813C7 fro...    44   0.56 
gi|10645601|gb|AC078832.7| Staphylococcus aureus clone sabac-135...    42   2.2  
gi|669026|gb|U20864.1| Caenorhabditis elegans cosmid F32A5, comp...    42   2.2  
gi|28461101|gb|AC129325.4| Mus musculus chromosome 1 clone RP23-...    42   2.2  
gi|25188968|gb|AC113266.22| Papio anubis clone rp41-106a4, compl...    42   2.2  
gi|16445204|gb|AC097513.2| Homo sapiens BAC clone RP11-419E3 fro...    42   2.2  
gi|14140350|gb|AC074347.8| Homo sapiens BAC clone RP11-646H18 fr...    42   2.2  
gi|14349226|dbj|AP003134.2| Staphylococcus aureus subsp. aureus ...    42   2.2  
gi|21204509|dbj|AP004827.1| Staphylococcus aureus subsp. aureus ...    42   2.2  
gi|13897301|emb|AL390334.4|CNS06C7N Human chromosome 14 DNA sequ...    42   2.2  
gi|12666245|emb|AL354997.17| Human DNA sequence from clone RP11-...    42   2.2  
gi|8272676|gb|AC069326.1|AC069326 Genomic Sequence For Arabidops...    42   2.2  
gi|14625566|emb|AL356111.13| Human DNA sequence from clone RP11-...    42   2.2  
gi|6110604|gb|AF193842.1|AF193842 Staphylococcus aureus DNA poly...    42   2.2  
gi|20218553|emb|AL356267.27| Human DNA sequence from clone RP11-...    42   2.2  
gi|14247399|dbj|AP003363.2| Staphylococcus aureus subsp. aureus ...    42   2.2  
gi|14277213|gb|AC018659.35| Homo sapiens 12 BAC RP11-528M18 (Ros...    40   8.7  
gi|28913272|gb|AC124157.3| Equus caballus clone CH241-37P10, com...    40   8.7  
gi|22003975|gb|AC108718.13| Homo sapiens 3 BAC RP11-246A10 (Rosw...    40   8.7  
gi|28201572|gb|AC109602.6| Oryza sativa chromosome 3 BAC OSJNBa0...    40   8.7  
gi|28380465|gb|AE003781.4| Drosophila melanogaster chromosome 2L...    40   8.7  
gi|13493036|gb|AC078789.16| Homo sapiens 12 BAC RP11-769N19 (Ros...    40   8.7  
gi|26108838|gb|AE016763.1| Escherichia coli CFT073 section 9 of ...    40   8.7  
gi|25989040|gb|AC009141.7| Homo sapiens chromosome 16 clone RP11...    40   8.7  
gi|17543635|ref|NM_070014.1| Caenorhabditis elegans putative RNA...    40   8.7  
gi|17543633|ref|NM_070013.1| Caenorhabditis elegans putative RNA...    40   8.7  
gi|24962954|gb|AC124774.4| Mus musculus chromosome 15 clone RP23...    40   8.7  
gi|12643007|gb|AC078872.13| Homo sapiens 12q BAC RP11-542G14 (Ro...    40   8.7  
gi|23296896|gb|AY142660.1| Arabidopsis thaliana putative histone...    40   8.7  
gi|23272340|gb|BC033551.1| Homo sapiens, clone IMAGE:4823265, mRNA     40   8.7  
gi|18176318|gb|AY072201.1| Arabidopsis thaliana putative histone...    40   8.7  
gi|18424665|ref|NM_125705.1| Arabidopsis thaliana chromosome 5  ...    40   8.7  
gi|21407088|gb|AY088314.1| Arabidopsis thaliana clone 5511 mRNA,...    40   8.7  
gi|20800383|gb|AC118061.4| Homo sapiens BAC clone RP11-318L9 fro...    40   8.7  
gi|20901838|gb|AC074321.10| Homo sapiens chromosome 10 clone RP1...    40   8.7  
gi|20270119|gb|AC116358.2| Homo sapiens chromosome 5 clone RP11-...    40   8.7  
gi|20136944|gb|AC110073.3| Homo sapiens BAC clone RP11-62A4 from...    40   8.7  
gi|19774360|gb|AC023170.10| Homo sapiens chromosome 10 clone RP1...    40   8.7  
gi|20087138|gb|AC114283.2| Homo sapiens chromosome 5 clone CTD-2...    40   8.7  
gi|20087111|gb|AC012472.7| Homo sapiens chromosome 10 clone RP11...    40   8.7  
gi|8650408|gb|AF217490.1|AF217491S3 Homo sapiens fragile 16D oxi...    40   8.7  
gi|19482373|gb|AC107385.4| Homo sapiens BAC clone RP11-158C21 fr...    40   8.7  
gi|19424481|gb|AC107878.2| Homo sapiens chromosome 18, clone RP1...    40   8.7  
gi|19424471|gb|AC103676.2| Homo sapiens chromosome 18, clone CTD...    40   8.7  
gi|18855174|gb|AC004112.2| Homo sapiens BAC clone CTA-313E3 from...    40   8.7  
gi|18464235|gb|AC067859.7| Homo sapiens chromosome 18, clone RP1...    40   8.7  
gi|17530777|gb|AC024995.8| Homo sapiens, clone RP11-328L11, comp...    40   8.7  
gi|28874554|emb|AL583857.3| Human DNA sequence from clone RP11-1...    40   8.7  
gi|4165302|emb|AJ011969.1|RNO011969 Rattus norvegicus MIC-1 gene...    40   8.7  
gi|5924005|emb|AL035697.19|HS45F6 Human DNA sequence from clone ...    40   8.7  
gi|15668155|gb|AC013409.8| Homo sapiens BAC clone RP11-471D6 fro...    40   8.7  
gi|13794423|gb|AF165818.4|AF165818 Guillardia theta nucleomorph ...    40   8.7  
gi|16303407|gb|AC010301.7| Homo sapiens chromosome 5 clone CTB-2...    40   8.7  
gi|15808589|gb|AC079054.6| Homo sapiens chromosome 8, clone RP11...    40   8.7  
gi|15718540|gb|AC026720.6| Homo sapiens chromosome 5 clone CTD-2...    40   8.7  
gi|15718527|gb|AC008693.9| Homo sapiens chromosome 5 clone CTB-6...    40   8.7  
gi|15619882|gb|AE008635.1|AE008635 Rickettsia conorii Malish 7, ...    40   8.7  
gi|15451719|gb|AC046181.7| Homo sapiens chromosome 18, clone RP1...    40   8.7  
gi|15431043|gb|AC009254.8| Drosophila melanogaster, chromosome 2...    40   8.7  
gi|15187254|gb|AC026719.4| Homo sapiens chromosome 5 clone CTD-2...    40   8.7  
gi|8886513|gb|AF164342.1|AF164342 Aspergillus nidulans histone d...    40   8.7  
gi|1628044|emb|Z81146.1|CEK10D11 Caenorhabditis elegans cosmid K...    40   8.7  
gi|27497287|emb|AL935040.6| Zebrafish DNA sequence from clone CH...    40   8.7  
gi|3810716|emb|AL032649.1|CEY55D9A Caenorhabditis elegans cosmid...    40   8.7  
gi|24816881|emb|AL773561.6| Mouse DNA sequence from clone RP23-7...    40   8.7  
gi|23953903|emb|AL139148.12| Human DNA sequence from clone RP4-6...    40   8.7  
gi|16414035|emb|AL596169.1| Listeria innocua Clip11262 complete ...    40   8.7  
gi|14089942|emb|AL445565.1|MPULM03 Mycoplasma pulmonis (strain U...    40   8.7  
gi|11066140|gb|AF195548.1|AF195548 Arabidopsis thaliana putative...    40   8.7  
gi|7684547|gb|AC011234.2|AC011234 Homo sapiens BAC clone RP11-16...    40   8.7  
gi|16944348|emb|AL445903.3|CNS07EEU Human chromosome 14 DNA sequ...    40   8.7  
gi|14250877|emb|AL157955.5|CNS01RGE Human chromosome 14 DNA sequ...    40   8.7  
gi|13940012|emb|AL157792.3|CNS01RG7 Human chromosome 14 DNA sequ...    40   8.7  
gi|14330140|emb|AL590810.8| Human DNA sequence from clone RP11-7...    40   8.7  
gi|12044672|emb|AL512348.8| Human DNA sequence from clone RP11-3...    40   8.7  
gi|9795038|emb|AL356115.9| Human DNA sequence from clone RP11-48...    40   8.7  
gi|18496240|emb|AL359510.24| Human DNA sequence from clone RP11-...    40   8.7  
gi|11321993|emb|AL357352.11| Human DNA sequence from clone RP11-...    40   8.7  
gi|16444670|emb|AL157714.8| Human DNA sequence from clone RP11-5...    40   8.7  
gi|8248660|emb|AL138809.18| Human DNA sequence from clone RP5-98...    40   8.7  
gi|4753289|gb|AC004825.2|AC004825 Homo sapiens PAC clone RP1-292...    40   8.7  
gi|14211658|dbj|AP003466.2| Homo sapiens genomic DNA, chromosome...    40   8.7  
gi|24413940|dbj|AP002837.2| Oryza sativa (japonica cultivar-grou...    40   8.7  
gi|3789713|gb|AC005828.1|AC005828 Homo sapiens chromosome 17, cl...    40   8.7  
gi|1930930|gb|AC001048.1|HSAC001048 Homo sapiens (subclone 1_f12...    40   8.7  
gi|21531354|emb|AL691499.7| Mouse DNA sequence from clone RP23-4...    40   8.7  
gi|21212372|emb|AL683887.15| Human DNA sequence from clone RP11-...    40   8.7  

ALIGNMENTS
>gi|1322818|emb|Z72716.1|SCYGL194C S.cerevisiae chromosome VII reading frame ORF YGL194c
          Length = 2372

 Score = 2208 bits (1114), Expect = 0.0
 Identities = 1114/1114 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1    atgtctggaacatttagttatgatgtgaaaacaaaggagaacgaaccattatttgagttt 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2183 atgtctggaacatttagttatgatgtgaaaacaaaggagaacgaaccattatttgagttt 2124

                                                                        
Query: 61   aattctgcttattctcccagggtatcgtatcattttaactccaaagtttcacattaccat 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2123 aattctgcttattctcccagggtatcgtatcattttaactccaaagtttcacattaccat 2064

                                                                        
Query: 121  tatggtgttaagcatccaatgaagccgtttcggttaatgctaacggatcacctagtttcc 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2063 tatggtgttaagcatccaatgaagccgtttcggttaatgctaacggatcacctagtttcc 2004

                                                                        
Query: 181  tcttatggattgcacaagattatggacctttatgaaacaagaagcgctaccagagacgaa 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2003 tcttatggattgcacaagattatggacctttatgaaacaagaagcgctaccagagacgaa 1944