MedBlast Result

MedBlast(0.8) Results

Direct References
Indirect References
Options
BLASTN
BLASTX

Direct References:

Hit	Evalue	SeqType	References
Z50046	0.0	N	Nature 1996 Sep 12;383(6596):185-8
NP_010444	0.0	P
Q03770	0.0	P
S57984	0.0	P
CAA90380	0.0	P
CAC67419	1e-74	P
EAA31076	2e-70	P
NP_015058	4e-61	P
P53388	4e-61	P
S65298	4e-61	P
CAA65074	4e-61	P
CAA98000	4e-61	P
AAB39866	3e-60	P
AAO32605	7e-60	P
CAB38005	3e-57	P
AAO32573	2e-56	P
EAA32636	3e-56	P
AAO32402	1e-55	P
AAO32502	4e-55	P
CAA47729	8e-55	P
NP_014131	1e-54	P
P32487	1e-54	P
S60914	1e-54	P	Chem Pharm Bull (Tokyo) 1991 Jul;39(7):1911-3 Chromosoma 1991 Jul;100(6):360-70 Cell Growth Differ 1991 Sep;2(9):429-37 Chromosoma 1991 Dec;101(3):180-8 Cell 1991 Nov 15;67(4):807-14 Cell Growth Differ 1991 Sep;2(9):447-56 Chromosoma 1991 Oct;101(1):32-40 Chromosoma 1991 Dec;101(4):214-21 Cell 1991 Oct 4;67(1):79-87 Cell 1991 Nov 29;67(5):853-68 Chromosoma 1991 May;100(4):229-34 Cell 1991 Nov 15;67(4):815-22 Cell 1991 Nov 15;67(4):823-32 Cell 1991 Nov 1;67(3):483-93 Cell 1991 Nov 15;67(4):661-73 Cell 1991 Oct 18;67(2):355-64 Cell 1991 Nov 15;67(4):675-80 Cell 1991 Oct 4;67(1):45-57 Cell 1991 Nov 29;67(5):869-77 Cell 1991 Nov 29;67(5):941-53 Cell 1991 Oct 18;67(2):437-47 Cell 1991 Nov 15;67(4):785-95 Cell 1991 Nov 15;67(4):797-805 Cell Regul 1991 Jun;2(6):453-65 Cell 1991 Oct 18;67(2):343-53 Cell 1991 Nov 1;67(3):469-81 Chromosoma 1991 Oct;101(1):19-24 Chromosoma 1991 Dec;101(3):169-79 Chromosoma 1991 Oct;101(1):25-31 Cell 1991 Nov 1;67(3):581-9 Cell 1991 Oct 4;67(1):59-77 Chromosoma 1991 Oct;101(1):49-54 Cell 1991 Nov 15;67(4):767-74 Cell 1991 Nov 1;67(3):629-39 Chromosoma 1991 Nov;101(2):109-14 Cell Regul 1991 Jul;2(7):523-34 Chromosoma 1991 Sep;100(8):510-8 Cell 1991 Nov 15;67(4):701-16 Cell 1991 Nov 15;67(4):717-22 Cell 1991 Oct 18;67(2):423-35
CAA63230	1e-54	P
CAA96175	1e-54	P
CAD30326	5e-54	P
NP_595009	9e-54	P
T39121	9e-54	P
CAB60020	9e-54	P
AAN52080	3e-53	P
AAO32401	8e-53	P
NP_014129	5e-52	P
P38971	5e-52	P
S60912	5e-52	P
CAA63228	5e-52	P
CAA96177	5e-52	P
AAO32499	3e-51	P
CAA52199	4e-51	P
NP_010851	1e-50	P
P04817	1e-50	P
QRBYPR	1e-50	P
AAA34467	1e-50	P
AAB65024	1e-50	P
NP_011707	1e-50	P
P06775	1e-50	P
S55869	1e-50	P
AAA34673	1e-50	P
CAA57802	1e-50	P
CAA97217	1e-50	P
CAA27416	1e-50	P
EAA35319	2e-50	P
NP_470133	4e-50	P
AG1531	4e-50	P
CAC96023	4e-50	P
NP_464325	8e-50	P
AF1174	8e-50	P
CAC98876	8e-50	P
NP_596348	1e-49	P
O60170	1e-49	P
T39829	1e-49	P
CAA19126	1e-49	P
NP_012965	2e-49	P
P19145	2e-49	P	Mol Plant Microbe Interact 1997 May;10(4):438-45
S38111	2e-49	P	Nucleic Acids Res 1991 Jun 11;19(11):3027-33 Nucleic Acids Res 1991 Jun 11;19(11):2987-91
CAA82113	2e-49	P
AAO32403	1e-48	P
NP_349939	4e-48	P
D97311	4e-48	P
AAK81279	4e-48	P
CAA36858	1e-47	P
NP_588250	8e-47	P
O74543	8e-47	P
T11710	8e-47	P
CAA20708	8e-47	P
AAO32571	1e-46	P
NP_349761	2e-46	P
B97289	2e-46	P
AAK81101	2e-46	P
NP_594316	2e-46	P
CAB88273	2e-46	P
AAL76065	1e-45	P
NP_764911	4e-45	P
AAO04955	4e-45	P
ZP_00063497	5e-45	P
1112180A	5e-45	P
NP_404904	1e-44	P
NP_670176	1e-44	P
AH0159	1e-44	P
CAC90139	1e-44	P
AAM86427	1e-44	P
S50711	1e-44	P
P43059	1e-44	P	Mol Plant Microbe Interact 1997 May;10(4):438-45
CAA54122	1e-44	P
NP_456758	2e-44	P
AH0782	2e-44	P
CAD02582	2e-44	P
ZP_00024229	2e-44	P
NP_374793	3e-44	P
G89951	3e-44	P
BAB42772	3e-44	P
NP_646442	4e-44	P
BAB95490	4e-44	P
NP_461145	7e-44	P
AAL21104	7e-44	P
EAA30854	7e-44	P
CAD37145	9e-44	P
NP_268350	2e-43	P
A86899	2e-43	P
AAK06291	2e-43	P

References Summary:

Walker SS, Reese JC, Apone LM, Green MR
Transcription activation in cells lacking TAFIIS.
Nature 1996 Sep 12;383(6596):185-8
PMID: 8774886
Nakajima O, Akiyama T, Hakamatsuka T, Shibuya M, Noguchi H, Ebizuka Y, Sankawa U
Isolation, sequence and bacterial expression of a cDNA for chalcone synthase from the cultured cells of Pueraria lobata.
Chem Pharm Bull (Tokyo) 1991 Jul;39(7):1911-3
PMID: 1777944
Sullivan KF, Glass CA
CENP-B is a highly conserved mammalian centromere protein with homology to the helix-loop-helix family of proteins.
Chromosoma 1991 Jul;100(6):360-70
PMID: 1893793
Teeter LD, Eckersberg T, Tsai Y, Kuo MT
Analysis of the Chinese hamster P-glycoprotein/multidrug resistance gene pgp1 reveals that the AP-1 site is essential for full promoter activity.
Cell Growth Differ 1991 Sep;2(9):429-37
PMID: 1661134
Penrad-Mobayed M, Sourrouille P, Bonnanfant-Jais ML, N'Da E, Edstrom JE, Angelier N
Microdissection and cloning of DNA from landmark loops of amphibian lampbrush chromosomes.
Chromosoma 1991 Dec;101(3):180-8
PMID: 1790731
Gray JT, Celander DW, Price CM, Cech TR
Cloning and expression of genes for the Oxytricha telomere-binding protein: specific subunit interactions in the telomeric complex.
Cell 1991 Nov 15;67(4):807-14
PMID: 1840510
Wolff CM, Stiegler P, Baltzinger M, Meyer D, Ghysdael J, Stehelin D, Befort N, Remy P
Cloning, sequencing, and expression of two Xenopus laevis c-ets-2 protooncogenes.
Cell Growth Differ 1991 Sep;2(9):447-56
PMID: 1751411
Saitoh Y, Saitoh H, Ohtomo K, Mizuno S
Occupancy of the majority of DNA in the chicken W chromosome by bent-repetitive sequences.
Chromosoma 1991 Oct;101(1):32-40
PMID: 1840511
Murakami S, Matsumoto T, Niwa O, Yanagida M
Structure of the fission yeast centromere cen3: direct analysis of the reiterated inverted region.
Chromosoma 1991 Dec;101(4):214-21
PMID: 1773660
Smith JC, Price BM, Green JB, Weigel D, Herrmann BG
Expression of a Xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm induction.
Cell 1991 Oct 4;67(1):79-87
PMID: 1717160
Mahoney PA, Weber U, Onofrechuk P, Biessmann H, Bryant PJ, Goodman CS
The fat tumor suppressor gene in Drosophila encodes a novel member of the cadherin gene superfamily.
Cell 1991 Nov 29;67(5):853-68
PMID: 1959133
Maggini F, Cremonini R, Zolfino C, Tucci GF, D'Ovidio R, Delre V, DePace C, Scarascia Mugnozza GT, Cionini PG
Structure and chromosomal localization of DNA sequences related to ribosomal subrepeats in Vicia faba.
Chromosoma 1991 May;100(4):229-34
PMID: 2055134
Muller F, Wicky C, Spicher A, Tobler H
New telomere formation after developmentally regulated chromosomal breakage during the process of chromatin diminution in Ascaris lumbricoides.
Cell 1991 Nov 15;67(4):815-22
PMID: 1934070
Yu GL, Blackburn EH
Developmentally programmed healing of chromosomes by telomerase in Tetrahymena.
Cell 1991 Nov 15;67(4):823-32
PMID: 1934071
Oppenheimer DG, Herman PL, Sivakumaran S, Esch J, Marks MD
A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules.
Cell 1991 Nov 1;67(3):483-93
PMID: 1934056
Yang XH, Seow KT, Bahri SM, Oon SH, Chia W
Two Drosophila receptor-like tyrosine phosphatase genes are expressed in a subset of developing axons and pioneer neurons in the embryonic CNS.
Cell 1991 Nov 15;67(4):661-73
PMID: 1657401
Derr LK, Strathern JN, Garfinkel DJ
RNA-mediated recombination in S. cerevisiae.
Cell 1991 Oct 18;67(2):355-64
PMID: 1655280
Tian SS, Tsoulfas P, Zinn K
Three receptor-linked protein-tyrosine phosphatases are selectively expressed on central nervous system axons in the Drosophila embryo.
Cell 1991 Nov 15;67(4):675-80
PMID: 1657402
Grenningloh G, Rehm EJ, Goodman CS
Genetic analysis of growth cone guidance in Drosophila: fasciclin II functions as a neuronal recognition molecule.
Cell 1991 Oct 4;67(1):45-57
PMID: 1913818
Amagai M, Klaus-Kovtun V, Stanley JR
Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion.
Cell 1991 Nov 29;67(5):869-77
PMID: 1720352
Vaessin H, Grell E, Wolff E, Bier E, Jan LY, Jan YN
prospero is expressed in neuronal precursors and encodes a nuclear protein that is involved in the control of axonal outgrowth in Drosophila.
Cell 1991 Nov 29;67(5):941-53
PMID: 1720353
Pelletier J, Bruening W, Kashtan CE, Mauer SM, Manivel JC, Striegel JE, Houghton DC, Junien C, Habib R, Fouser L, et al
Germline mutations in the Wilms' tumor suppressor gene are associated with abnormal urogenital development in Denys-Drash syndrome.
Cell 1991 Oct 18;67(2):437-47
PMID: 1655284
Lopez-Casillas F, Cheifetz S, Doody J, Andres JL, Lane WS, Massague J
Structure and expression of the membrane proteoglycan betaglycan, a component of the TGF-beta receptor system.
Cell 1991 Nov 15;67(4):785-95
PMID: 1657406
Wang XF, Lin HY, Ng-Eaton E, Downward J, Lodish HF, Weinberg RA
Expression cloning and characterization of the TGF-beta type III receptor.
Cell 1991 Nov 15;67(4):797-805
PMID: 1657407
Wang Y, Boguski M, Riggs M, Rodgers L, Wigler M
sar1, a gene from Schizosaccharomyces pombe encoding a protein that regulates ras1.
Cell Regul 1991 Jun;2(6):453-65
PMID: 1883874
Romero DP, Blackburn EH
A conserved secondary structure for telomerase RNA.
Cell 1991 Oct 18;67(2):343-53
PMID: 1840508
Shimell MJ, Ferguson EL, Childs SR, O'Connor MB
The Drosophila dorsal-ventral patterning gene tolloid is related to human bone morphogenetic protein 1.
Cell 1991 Nov 1;67(3):469-81
PMID: 1840509
Lin CC, Sasi R, Fan YS, Chen ZQ
New evidence for tandem chromosome fusions in the karyotypic evolution of Asian muntjacs.
Chromosoma 1991 Oct;101(1):19-24
PMID: 1769270
Steinemann M, Steinemann S
Preferential Y chromosomal location of TRIM, a novel transposable element of Drosophila miranda, obscura group.
Chromosoma 1991 Dec;101(3):169-79
PMID: 1665124
Hankeln T, Schmidt ER
The organization, localization and nucleotide sequence of the histone genes of the midge Chironomus thummi.
Chromosoma 1991 Oct;101(1):25-31
PMID: 1769271
Bardwell JC, McGovern K, Beckwith J
Identification of a protein required for disulfide bond formation in vivo.
Cell 1991 Nov 1;67(3):581-9
PMID: 1934062
Koelle MR, Talbot WS, Segraves WA, Bender MT, Cherbas P, Hogness DS
The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily.
Cell 1991 Oct 4;67(1):59-77
PMID: 1913820
Furia M, Digilio FA, Artiaco D, D'Avino PP, Cavaliere D, Polito LC
Molecular organization of the Drosophila melanogaster Pig-1 gene.
Chromosoma 1991 Oct;101(1):49-54
PMID: 1769273
Epstein DJ, Vekemans M, Gros P
Splotch (Sp2H), a mutation affecting development of the mouse neural tube, shows a deletion within the paired homeodomain of Pax-3.
Cell 1991 Nov 15;67(4):767-74
PMID: 1682057
Tian Q, Streuli M, Saito H, Schlossman SF, Anderson P
A polyadenylate binding protein localized to the granules of cytolytic lymphocytes induces DNA fragmentation in target cells.
Cell 1991 Nov 1;67(3):629-39
PMID: 1934064
Baldini A, Miller DA, Shridhar V, Rocchi M, Miller OJ, Ward DC
Comparative mapping of a gorilla-derived alpha satellite DNA clone on great ape and human chromosomes.
Chromosoma 1991 Nov;101(2):109-14
PMID: 1769275
Pasquale EB
Identification of chicken embryo kinase 5, a developmentally regulated receptor-type tyrosine kinase of the Eph family.
Cell Regul 1991 Jul;2(7):523-34
PMID: 1664238
Sala-Rovira M, Geraud ML, Caput D, Jacques F, Soyer-Gobillard MO, Vernet G, Herzog M
Molecular cloning and immunolocalization of two variants of the major basic nuclear protein (HCc) from the histone-less eukaryote Crypthecodinium cohnii (Pyrrhophyta).
Chromosoma 1991 Sep;100(8):510-8
PMID: 1764969
Simon MA, Bowtell DD, Dodson GS, Laverty TR, Rubin GM
Ras1 and a putative guanine nucleotide exchange factor perform crucial steps in signaling by the sevenless protein tyrosine kinase.
Cell 1991 Nov 15;67(4):701-16
PMID: 1934068
Hariharan IK, Carthew RW, Rubin GM
The Drosophila roughened mutation: activation of a rap homolog disrupts eye development and interferes with cell determination.
Cell 1991 Nov 15;67(4):717-22
PMID: 1934069
Legouis R, Hardelin JP, Levilliers J, Claverie JM, Compain S, Wunderle V, Millasseau P, Le Paslier D, Cohen D, Caterina D, et al
The candidate gene for the X-linked Kallmann syndrome encodes a protein related to adhesion molecules.
Cell 1991 Oct 18;67(2):423-35
PMID: 1913827
Hahn M, Neef U, Struck C, Gottfert M, Mendgen K
A putative amino acid transporter is specifically expressed in haustoria of the rust fungus Uromyces fabae.
Mol Plant Microbe Interact 1997 May;10(4):438-45
PMID: 9150593
Yi TM, Walsh K, Schimmel P
Rabbit muscle creatine kinase: genomic cloning, sequencing, and analysis of upstream sequences important for expression in myocytes.
Nucleic Acids Res 1991 Jun 11;19(11):3027-33
PMID: 2057360
Li YQ, Ye LZ, Sugita M, Sugiura M
Tobacco nuclear gene for the 31 kd chloroplast ribonucleoprotein: genomic organization, sequence analysis and expression.
Nucleic Acids Res 1991 Jun 11;19(11):2987-91
PMID: 2057356

Indirect References:

Hit	Evalue	SeqType	References
Z50046	0.0	N
NP_010444	0.0	P	ssy1p Curr Genet 2002 May;41(2):63-72 Genetics 2001 Jul;158(3):973-88 Mol Microbiol 2001 Jul;41(2):489-502 Mol Microbiol 1998 Feb;27(3):643-50 Mol Cell Biol 1999 Aug;19(8):5405-16 Mol Cell Biol 2001 Feb;21(3):814-26 Yeast 1998 Jan 30;14(2):103-14 Mol Cell Biol 1999 Feb;19(2):989-1001 Yeast 2001 Sep 15;18(12):1155-71 Mol Microbiol 2001 Oct;42(1):215-28 shr10 (-) ssy1 Genetics 2001 Jul;158(3):973-88 Mol Cell Biol 2001 Feb;21(3):814-26 Curr Genet 2002 May;41(2):63-72 Mol Membr Biol 2001 Jan-Mar;18(1):105-12 Curr Genet 2001 Sep;40(2):91-109 Mol Microbiol 2001 Jul;41(2):489-502 Mol Cell Biol 1999 Aug;19(8):5405-16 Yeast 1998 Jan 30;14(2):103-14 Biochem Biophys Res Commun 2002 Jun 28;294(5):962-7 Mol Microbiol 1998 Feb;27(3):643-50 Curr Genet 1999 Dec;36(6):317-28 Mol Cell Biol 1999 Feb;19(2):989-1001 Mol Microbiol 2001 Oct;42(1):215-28 Mol Gen Genet 2001 Jan;264(5):613-22 FEBS Lett 2001 May 11;496(2-3):81-5 Yeast 2002 Jan 30;19(2):115-22 shr10p (-)
Q03770	0.0	P
S57984	0.0	P
CAA90380	0.0	P
CAC67419	1e-74	P	aat1 (-)
EAA31076	2e-70	P
NP_015058	4e-61	P	dip5p Curr Genet 1998 Mar;33(3):171-7 Curr Genet 1999 Dec;36(6):317-28 dip5 Curr Genet 1998 Mar;33(3):171-7 Curr Genet 2002 May;41(2):63-72 Mol Microbiol 2001 Oct;42(1):215-28
P53388	4e-61	P
S65298	4e-61	P
CAA65074	4e-61	P	dip5p (...) dip5 (...)
CAA98000	4e-61	P	dip5p (...) dip5 (...)
AAB39866	3e-60	P	pig2 (-)
AAO32605	7e-60	P
CAB38005	3e-57	P	aat1 (-)
AAO32573	2e-56	P
EAA32636	3e-56	P
AAO32402	1e-55	P
AAO32502	4e-55	P
CAA47729	8e-55	P	lyp1 Folia Microbiol (Praha) 1996;41(1):107-9 Yeast 1994 Dec;10(12):1647-51 FEMS Microbiol Lett 1993 Oct 1;113(1):57-61 Yeast 1993 Jul;9(7):771-82 Yeast 1996 Apr;12(5):505-14 Yeast 1994 May;10(5):653-7 Genetics 2002 Jun;161(2):563-74 lyp1p Genetics 1997 Dec;147(4):1569-84 Curr Genet 1999 Dec;36(6):317-28
NP_014131	1e-54	P	lyp1 (...) lyp1p (...)
P32487	1e-54	P
S60914	1e-54	P
CAA63230	1e-54	P	lyp1 (...) lyp1p (...)
CAA96175	1e-54	P	lyp1 (...) lyp1p (...)
CAD30326	5e-54	P	arlp Biochim Biophys Acta 2002 Sep 20;1565(1):73-80
NP_595009	9e-54	P
T39121	9e-54	P
CAB60020	9e-54	P
AAN52080	3e-53	P	gap1 (-)
AAO32401	8e-53	P
NP_014129	5e-52	P	alp1 J Cell Biol 2000 May 29;149(5):1087-96 FEBS Lett 2000 Feb 18;468(1):84-8 alp1p Curr Genet 1999 Dec;36(6):317-28
P38971	5e-52	P
S60912	5e-52	P
CAA63228	5e-52	P	apl1 J Cell Sci 1995 Apr;108 ( Pt 4):1605-15 Yeast 1996 Apr;12(5):505-14 Yeast 1994 May;10(5):653-7 apl1p (-) yap80p (-) yap80 (-)
CAA96177	5e-52	P	alp1 (...) alp1p (...)
AAO32499	3e-51	P
CAA52199	4e-51	P	apl1 (...) apl1p (-) yap80p (-) yap80 (-)
NP_010851	1e-50	P	can1p FEBS Lett 1997 May 12;408(1):89-93 Eukaryot Cell 2002 Aug;1(4):606-12 Genetics 1997 Dec;147(4):1569-84 Biochim Biophys Acta 2002 Aug 19;1564(1):9-13 Curr Genet 1999 Dec;36(6):317-28 Yeast 2001 Feb;18(3):251-60 Yeast 2001 Nov;18(15):1429-40 Yeast 1995 Jun 15;11(7):681-9 J Biol Chem 2000 Apr 14;275(15):11198-206 Mol Microbiol 1997 May;24(3):607-16 Yeast 1998 Feb;14(3):215-24 can1 FEMS Microbiol Lett 1997 Jul 15;152(2):261-7 Genetics 2002 Apr;160(4):1409-22 Genetics 2002 Oct;162(2):579-89 J Biol Chem 2001 Aug 3;276(31):28659-66 Proc Natl Acad Sci U S A 2001 Apr 24;98(9):5122-7 Yeast 1996 Nov;12(14):1393-405 Curr Genet 1998 Jul;34(1):21-9 Yeast 2002 Apr;19(6):553-64 Yeast 2001 Nov;18(15):1429-40 Yeast 1995 Jun 15;11(7):681-9 Mutat Res 1998 Mar;407(2):135-45 J Biol Chem 2000 Apr 14;275(15):11198-206 Mol Cell Biol 1999 May;19(5):3588-99 Yeast 1994 May;10(5):653-7 Mol Cell Biol 1999 Nov;19(11):7801-15 Proc Natl Acad Sci U S A 2001 Aug 14;98(17):9760-5 Genetics 2001 May;158(1):109-22 Yeast 1993 Jul;9(7):771-82 Genetics 1996 Feb;142(2):383-91 Genetics 1996 Mar;142(3):761-76 J Biol Chem 2000 Jun 9;275(23):17611-8 Yeast 1994 Dec;10(12):1647-51 Yeast 1998 Feb;14(3):215-24 Bioelectromagnetics 2000 Oct;21(7):515-23 FEMS Microbiol Lett 1999 Jul 1;176(1):257-62 Curr Genet 1995 May;27(6):496-500 Mol Cell Biol 2001 Aug;21(15):4889-99 Enzyme Microb Technol 2000 Dec;27(10):806-811 Curr Genet 2002 May;41(2):63-72 Curr Genet 2000 Nov;38(4):178-87 Gene 2002 May 29;291(1-2):251-7 Folia Microbiol (Praha) 1997;42(3):243-4 J Bacteriol 1995 Dec;177(23):6910-8 FEBS Lett 1997 May 12;408(1):89-93 Genetics 1994 Jan;136(1):87-91 Genetics 1999 Apr;151(4):1393-407 Cell 2001 Aug 10;106(3):275-86 Biochim Biophys Acta 2002 Aug 19;1564(1):9-13 Curr Genet 1999 Dec;36(6):317-28 Folia Microbiol (Praha) 1996;41(1):107-9 [Total: 70. Click here for MORE]
P04817	1e-50	P
QRBYPR	1e-50	P
AAA34467	1e-50	P
AAB65024	1e-50	P	can1p (...) can1 (...)
NP_011707	1e-50	P	hip1p Genetics 1997 Dec;147(4):1569-84 J Bacteriol 1999 Aug;181(16):4774-9 Mol Gen Genet 1998 Sep;259(5):541-8 J Cell Biol 1996 Nov;135(3):585-95 Biochem Biophys Res Commun 1999 Dec 9;266(1):135-40 hip1 Hum Mol Genet 1997 Mar;6(3):487-95 J Biol Chem 1997 May 23;272(21):13647-52 Nat Genet 1997 May;16(1):44-53 Biochem Biophys Res Commun 1998 Feb 4;243(1):205-9 Mol Gen Genet 1998 Sep;259(5):541-8 Gene 1989 Nov 15;83(1):153-9 J Cell Biol 1999 Dec 27;147(7):1503-18 J Bacteriol 1991 Jun;173(12):3622-9 Proc Natl Acad Sci U S A 1992 Jul 1;89(13):6060-4 J Mol Evol 1988;27(4):341-50 Curr Genet 1999 Dec;36(6):317-28 Curr Genet 1999 Sep;36(3):113-23 Folia Microbiol (Praha) 1996;41(1):93 Yeast 1995 May;11(6):587-91 Mamm Genome 2000 Nov;11(11):1006-15 Gene 1985;38(1-3):205-14
P06775	1e-50	P
S55869	1e-50	P
AAA34673	1e-50	P
CAA57802	1e-50	P	g7572 Yeast 1995 May;11(6):587-91
CAA97217	1e-50	P	hip1p (...) hip1 (...)
CAA27416	1e-50	P
EAA35319	2e-50	P
NP_470133	4e-50	P	lin0791 (-)
AG1531	4e-50	P
CAC96023	4e-50	P	lin0791 (-)
NP_464325	8e-50	P	lmo0798 (-)
AF1174	8e-50	P
CAC98876	8e-50	P	lmo0798 (-)
NP_596348	1e-49	P
O60170	1e-49	P
T39829	1e-49	P
CAA19126	1e-49	P
NP_012965	2e-49	P	gap1 (-) gap1p Mol Microbiol 1995 Oct;18(1):77-87 J Cell Biol 2002 Dec 23;159(6):915-21 Proc Natl Acad Sci U S A 2002 Nov 12;99(23):14837-42 J Biol Chem 2000 Oct 6;275(40):31488-95 Genetics 1997 Dec;147(4):1569-84 J Cell Biol 2000 Mar 6;148(5):925-30 Yeast 2001 Feb;18(3):251-60 Mol Cell Biol 1999 May;19(5):3360-71 J Cell Sci 1999 May;112 ( Pt 9):1375-83 Curr Genet 1999 Jul;35(6):609-17 Biochem Biophys Res Commun 2002 Jun 28;294(5):962-7 J Biol Chem 1999 Jun 25;274(26):18747-52 J Cell Biol 1997 Jun 30;137(7):1469-82 J Cell Biol 2001 May 14;153(4):649-62 Mol Biol Cell 1999 Nov;10(11):3549-65 Curr Genet 1999 Dec;36(6):317-28 J Cell Biol 1996 Nov;135(3):585-95 Gene 2002 May 15;290(1-2):1-18 Biochem Biophys Res Commun 2001 Oct 12;287(5):1045-50 J Bacteriol 1996 Apr;178(7):2025-9 Mol Microbiol 1997 May;24(3):607-16
P19145	2e-49	P
S38111	2e-49	P
CAA82113	2e-49	P	gap1 (-) gap1p (...)
AAO32403	1e-48	P
NP_349939	4e-48	P	cac3347 (-)
D97311	4e-48	P
AAK81279	4e-48	P	cac3347 (-)
CAA36858	1e-47	P
NP_588250	8e-47	P
O74543	8e-47	P
T11710	8e-47	P
CAA20708	8e-47	P
AAO32571	1e-46	P
NP_349761	2e-46	P	cac3164 (-)
B97289	2e-46	P
AAK81101	2e-46	P	cac3164 (-)
NP_594316	2e-46	P
CAB88273	2e-46	P
AAL76065	1e-45	P
NP_764911	4e-45	P	se1356 (-)
AAO04955	4e-45	P	se1356 (-)
ZP_00063497	5e-45	P	lmes0985 (-)
1112180A	5e-45	P
NP_404904	1e-44	P	lysp (-)
NP_670176	1e-44	P	lysp (-)
AH0159	1e-44	P
CAC90139	1e-44	P	lysp (-)
AAM86427	1e-44	P	lysp (-)
S50711	1e-44	P
P43059	1e-44	P
CAA54122	1e-44	P	can1 (...)
NP_456758	2e-44	P	lysp (-)
AH0782	2e-44	P
CAD02582	2e-44	P	sty2435 (-)
ZP_00024229	2e-44	P	reut3201 (-)
NP_374793	3e-44	P	lysp (-)
G89951	3e-44	P
BAB42772	3e-44	P	lysp (-)
NP_646442	4e-44	P	lysp (-)
BAB95490	4e-44	P	lysp (-)
NP_461145	7e-44	P	lysp (-)
AAL21104	7e-44	P	lysp (-)
EAA30854	7e-44	P
CAD37145	9e-44	P
NP_268350	2e-43	P	lysp (-)
A86899	2e-43	P
AAK06291	2e-43	P	lysp (-)

References Summary:

Kodama Y, Omura F, Takahashi K, Shirahige K, Ashikari T
Genome-wide expression analysis of genes affected by amino acid sensor Ssy1p in Saccharomyces cerevisiae.
Curr Genet 2002 May;41(2):63-72
PMID: 12073087
Forsberg H, Hammar M, Andreasson C, Moliner A, Ljungdahl PO
Suppressors of ssy1 and ptr3 null mutations define novel amino acid sensor-independent genes in Saccharomyces cerevisiae.
Genetics 2001 Jul;158(3):973-88
PMID: 11454748
Bernard F, Andre B
Genetic analysis of the signalling pathway activated by external amino acids in Saccharomyces cerevisiae.
Mol Microbiol 2001 Jul;41(2):489-502
PMID: 11489133
Didion T, Regenberg B, Jorgensen MU, Kielland-Brandt MC, Andersen HA
The permease homologue Ssy1p controls the expression of amino acid and peptide transporter genes in Saccharomyces cerevisiae.
Mol Microbiol 1998 Feb;27(3):643-50
PMID: 9489675
Klasson H, Fink GR, Ljungdahl PO
Ssy1p and Ptr3p are plasma membrane components of a yeast system that senses extracellular amino acids.
Mol Cell Biol 1999 Aug;19(8):5405-16
PMID: 10409731
Forsberg H, Ljungdahl PO
Genetic and biochemical analysis of the yeast plasma membrane Ssy1p-Ptr3p-Ssy5p sensor of extracellular amino acids.
Mol Cell Biol 2001 Feb;21(3):814-26
PMID: 11154269
Jorgensen MU, Bruun MB, Didion T, Kielland-Brandt MC
Mutations in five loci affecting GAP1-independent uptake of neutral amino acids in yeast.
Yeast 1998 Jan 30;14(2):103-14
PMID: 9483800
Iraqui I, Vissers S, Bernard F, de Craene JO, Boles E, Urrestarazu A, Andre B
Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-Box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease.
Mol Cell Biol 1999 Feb;19(2):989-1001
PMID: 9891035
Georgakopoulos T, Koutroubas G, Vakonakis I, Tzermia M, Prokova V, Voutsina A, Alexandraki D
Functional analysis of the Saccharomyces cerevisiae YFR021w/YGR223c/YPL100w ORF family suggests relations to mitochondrial/peroxisomal functions and amino acid signalling pathways.
Yeast 2001 Sep 15;18(12):1155-71
PMID: 11536337
Forsberg H, Gilstring CF, Zargari A, Martinez P, Ljungdahl PO
The role of the yeast plasma membrane SPS nutrient sensor in the metabolic response to extracellular amino acids.
Mol Microbiol 2001 Oct;42(1):215-28
PMID: 11679080
Hauser M, Narita V, Donhardt AM, Naider F, Becker JM
Multiplicity and regulation of genes encoding peptide transporters in Saccharomyces cerevisiae.
Mol Membr Biol 2001 Jan-Mar;18(1):105-12
PMID: 11396605
Forsberg H, Ljungdahl PO
Sensors of extracellular nutrients in Saccharomyces cerevisiae.
Curr Genet 2001 Sep;40(2):91-109
PMID: 11680826
Zikanova B, Kuthan M, Ricicova M, Forstova J, Palkova Z
Amino acids control ammonia pulses in yeast colonies.
Biochem Biophys Res Commun 2002 Jun 28;294(5):962-7
PMID: 12074570
Regenberg B, During-Olsen L, Kielland-Brandt MC, Holmberg S
Substrate specificity and gene expression of the amino-acid permeases in Saccharomyces cerevisiae.
Curr Genet 1999 Dec;36(6):317-28
PMID: 10654085
Nielsen PS, van den Hazel B, Didion T, de Boer M, Jorgensen M, Planta RJ, Kielland-Brandt MC, Andersen HA
Transcriptional regulation of the Saccharomyces cerevisiae amino acid permease gene BAP2.
Mol Gen Genet 2001 Jan;264(5):613-22
PMID: 11212916
Bernard F, Andre B
Ubiquitin and the SCF(Grr1) ubiquitin ligase complex are involved in the signalling pathway activated by external amino acids in Saccharomyces cerevisiae.
FEBS Lett 2001 May 11;496(2-3):81-5
PMID: 11356187
Nigavekar SS, Cannon JF
Characterization of genes that are synthetically lethal with ade3 or leu2 in Saccharomyces cerevisiae.
Yeast 2002 Jan 30;19(2):115-22
PMID: 11788966
Regenberg B, Holmberg S, Olsen LD, Kielland-Brandt MC
Dip5p mediates high-affinity and high-capacity transport of L-glutamate and L-aspartate in Saccharomyces cerevisiae.
Curr Genet 1998 Mar;33(3):171-7
PMID: 9508791
Matejckova A, Sychrova H
Properties of Candida albicans CAN1 permease expressed in Saccharomyces cerevisiae.
Folia Microbiol (Praha) 1996;41(1):107-9
PMID: 9090844
Sychrova H, Souciet JL
CAN1, a gene encoding a permease for basic amino acids in Candida albicans.
Yeast 1994 Dec;10(12):1647-51
PMID: 7725800
Sychrova H, Matejckova A, Kotyk A
Kinetic properties of yeast lysine permeases coded by genes on multi-copy vectors.
FEMS Microbiol Lett 1993 Oct 1;113(1):57-61
PMID: 8243983
Sychrova H, Chevallier MR
Cloning and sequencing of the Saccharomyces cerevisiae gene LYP1 coding for a lysine-specific permease.
Yeast 1993 Jul;9(7):771-82
PMID: 8368011
Sen-Gupta M, Lyck R, Fleig U, Niedenthal RK, Hegemann JH
The sequence of a 24,152 bp segment from the left arm of chromosome XIV from Saccharomyces cerevisiae between the BNI1 and the POL2 genes.
Yeast 1996 Apr;12(5):505-14
PMID: 8740425
Sychrova H, Chevallier MR
APL1, a yeast gene encoding a putative permease for basic amino acids.
Yeast 1994 May;10(5):653-7
PMID: 7941748
Palmer LK, Wolfe D, Keeley JL, Keil RL
Volatile anesthetics affect nutrient availability in yeast.
Genetics 2002 Jun;161(2):563-74
PMID: 12072454
Roberg KJ, Bickel S, Rowley N, Kaiser CA
Control of amino acid permease sorting in the late secretory pathway of Saccharomyces cerevisiae by SEC13, LST4, LST7 and LST8.
Genetics 1997 Dec;147(4):1569-84
PMID: 9409822
Trip H, Evers ME, Konings WN, Driessen AJ
Cloning and characterization of an aromatic amino acid and leucine permease of Penicillium chrysogenum.
Biochim Biophys Acta 2002 Sep 20;1565(1):73-80
PMID: 12225854
Bhamidipati A, Lewis SA, Cowan NJ
ADP ribosylation factor-like protein 2 (Arl2) regulates the interaction of tubulin-folding cofactor D with native tubulin.
J Cell Biol 2000 May 29;149(5):1087-96
PMID: 10831612
Radcliffe PA, Vardy L, Toda T
A conserved small GTP-binding protein Alp41 is essential for the cofactor-dependent biogenesis of microtubules in fission yeast.
FEBS Lett 2000 Feb 18;468(1):84-8
PMID: 10683446
Rad MR, Phan HL, Kirchrath L, Tan PK, Kirchhausen T, Hollenberg CP, Payne GS
Saccharomyces cerevisiae Apl2p, a homologue of the mammalian clathrin AP beta subunit, plays a role in clathrin-dependent Golgi functions.
J Cell Sci 1995 Apr;108 ( Pt 4):1605-15
PMID: 7615679
Matijekova A, Sychrova H
Biogenesis of Candida albicans Can1 permease expressed in Saccharomyces cerevisiae.
FEBS Lett 1997 May 12;408(1):89-93
PMID: 9180275
Chattopadhyay S, Pearce DA
Interaction with Btn2p is required for localization of Rsglp: Btn2p-mediated changes in arginine uptake in Saccharomyces cerevisiae.
Eukaryot Cell 2002 Aug;1(4):606-12
PMID: 12456008
Opekarova M, Robl I, Tanner W
Phosphatidyl ethanolamine is essential for targeting the arginine transporter Can1p to the plasma membrane of yeast.
Biochim Biophys Acta 2002 Aug 19;1564(1):9-13
PMID: 12100990
Robl I, Grassl R, Tanner W, Opekarova M
Construction of phosphatidylethanolamine-less strain of Saccharomyces cerevisiae. Effect on amino acid transport.
Yeast 2001 Feb;18(3):251-60
PMID: 11180458
Regenberg B, Kielland-Brandt MC
Amino acid residues important for substrate specificity of the amino acid permeases Can1p and Gnp1p in Saccharomyces cerevisiae.
Yeast 2001 Nov;18(15):1429-40
PMID: 11746604
Miosga T, Schaaff-Gerstenschlager I, Chalwatzis N, Baur A, Boles E, Fournier C, Schmitt S, Velten C, Wilhelm N, Zimmermann FK
Sequence analysis of a 33.1 kb fragment from the left arm of Saccharomyces cerevisiae chromosome X, including putative proteins with leucine zippers, a fungal Zn(II)2-Cys6 binuclear cluster domain and a putative alpha 2-SCB-alpha 2 binding site.
Yeast 1995 Jun 15;11(7):681-9
PMID: 7483841
Urano J, Tabancay AP, Yang W, Tamanoi F
The Saccharomyces cerevisiae Rheb G-protein is involved in regulating canavanine resistance and arginine uptake.
J Biol Chem 2000 Apr 14;275(15):11198-206
PMID: 10753927
Hein C, Andre B
A C-terminal di-leucine motif and nearby sequences are required for NH4(+)-induced inactivation and degradation of the general amino acid permease, Gap1p, of Saccharomyces cerevisiae.
Mol Microbiol 1997 May;24(3):607-16
PMID: 9179853
Opekarova M, Caspari T, Pinson B, Brethes D, Tanner W
Post-translational fate of CAN1 permease of Saccharomyces cerevisiae.
Yeast 1998 Feb;14(3):215-24
PMID: 9544242
Opekarova M, Kubin J
On the unidirectionality of arginine uptake in the yeast Saccharomyces cerevisiae.
FEMS Microbiol Lett 1997 Jul 15;152(2):261-7
PMID: 9231419
Huang ME, Rio AG, Galibert MD, Galibert F
Pol32, a subunit of Saccharomyces cerevisiae DNA polymerase delta, suppresses genomic deletions and is involved in the mutagenic bypass pathway.
Genetics 2002 Apr;160(4):1409-22
PMID: 11973297
Bhattacharyya S, Rolfsmeier ML, Dixon MJ, Wagoner K, Lahue RS
Identification of RTG2 as a modifier gene for CTG*CAG repeat instability in Saccharomyces cerevisiae.
Genetics 2002 Oct;162(2):579-89
PMID: 12399373
van der Merwe GK, Cooper TG, van Vuuren HJ
Ammonia regulates VID30 expression and Vid30p function shifts nitrogen metabolism toward glutamate formation especially when Saccharomyces cerevisiae is grown in low concentrations of ammonia.
J Biol Chem 2001 Aug 3;276(31):28659-66
PMID: 11356843
Jin YH, Obert R, Burgers PM, Kunkel TA, Resnick MA, Gordenin DA
The 3'-->5' exonuclease of DNA polymerase delta can substitute for the 5' flap endonuclease Rad27/Fen1 in processing Okazaki fragments and preventing genome instability.
Proc Natl Acad Sci U S A 2001 Apr 24;98(9):5122-7
PMID: 11309502
Paluh JL, Clayton DA
Mutational analysis of the gene for Schizosaccharomyces pombe RNase MRP RNA, mrp1, using plasmid shuffle by counterselection on canavanine.
Yeast 1996 Nov;12(14):1393-405
PMID: 8948095
Johnson RE, Kovvali GK, Prakash L, Prakash S
Role of yeast Rth1 nuclease and its homologs in mutation avoidance, DNA repair, and DNA replication.
Curr Genet 1998 Jul;34(1):21-9
PMID: 9683672
Zang Y, Garre M, Gjuracic K, Bruschi CV
Chromosome V loss due to centromere knockout or MAD2-deletion is immediately followed by restitution of homozygous diploidy in Saccharomyces cerevisiae.
Yeast 2002 Apr;19(6):553-64
PMID: 11921104
Liefshitz B, Steinlauf R, Friedl A, Eckardt-Schupp F, Kupiec M
Genetic interactions between mutants of the 'error-prone' repair group of Saccharomyces cerevisiae and their effect on recombination and mutagenesis.
Mutat Res 1998 Mar;407(2):135-45
PMID: 9637242
Li Y, Kane T, Tipper C, Spatrick P, Jenness DD
Yeast mutants affecting possible quality control of plasma membrane proteins.
Mol Cell Biol 1999 May;19(5):3588-99
PMID: 10207082
Chen C, Merrill BJ, Lau PJ, Holm C, Kolodner RD
Saccharomyces cerevisiae pol30 (proliferating cell nuclear antigen) mutations impair replication fidelity and mismatch repair.
Mol Cell Biol 1999 Nov;19(11):7801-15
PMID: 10523669
Tran PT, Simon JA, Liskay RM
Interactions of Exo1p with components of MutLalpha in Saccharomyces cerevisiae.
Proc Natl Acad Sci U S A 2001 Aug 14;98(17):9760-5
PMID: 11481425
Rattray AJ, McGill CB, Shafer BK, Strathern JN
Fidelity of mitotic double-strand-break repair in Saccharomyces cerevisiae: a role for SAE2/COM1.
Genetics 2001 May;158(1):109-22
PMID: 11333222
Tsukamoto Y, Kato J, Ikeda H
Effects of mutations of RAD50, RAD51, RAD52, and related genes on illegitimate recombination in Saccharomyces cerevisiae.
Genetics 1996 Feb;142(2):383-91
PMID: 8852838
Rinckel LA, Garfinkel DJ
Influences of histone stoichiometry on the target site preference of retrotransposons Ty1 and Ty2 in Saccharomyces cerevisiae.
Genetics 1996 Mar;142(3):761-76
PMID: 8849886
Cox KH, Rai R, Distler M, Daugherty JR, Coffman JA, Cooper TG
Saccharomyces cerevisiae GATA sequences function as TATA elements during nitrogen catabolite repression and when Gln3p is excluded from the nucleus by overproduction of Ure2p.
J Biol Chem 2000 Jun 9;275(23):17611-8
PMID: 10748041
Gos P, Eicher B, Kohli J, Heyer WD
No mutagenic or recombinogenic effects of mobile phone fields at 900 MHz detected in the yeast Saccharomyces cerevisiae.
Bioelectromagnetics 2000 Oct;21(7):515-23
PMID: 11015116
Matejckova-Forejtova A, Kinclova O, Sychrova H
Degradation of Candida albicans Can1 permease expressed in Saccharomyces cerevisiae.
FEMS Microbiol Lett 1999 Jul 1;176(1):257-62
PMID: 10418152
Roche H, Ramachandran K, Kunz BA
Failure to detect an antimutator phenotype following disruption of the Saccharomyces cerevisiae DDR48 gene.
Curr Genet 1995 May;27(6):496-500
PMID: 7553932
Xie Y, Liu Y, Argueso JL, Henricksen LA, Kao HI, Bambara RA, Alani E
Identification of rad27 mutations that confer differential defects in mutation avoidance, repeat tract instability, and flap cleavage.
Mol Cell Biol 2001 Aug;21(15):4889-99
PMID: 11438646
Kondo A, Liu Y, Furuta M, Fujita Y, Matsumoto T, Fukuda H
Preparation of high activity whole cell biocatalyst by permeabilization of recombinant flocculent yeast with alcohol.
Enzyme Microb Technol 2000 Dec;27(10):806-811
PMID: 11118590
Huang ME, de Calignon A, Nicolas A, Galibert F
POL32, a subunit of the Saccharomyces cerevisiae DNA polymerase delta, defines a link between DNA replication and the mutagenic bypass repair pathway.
Curr Genet 2000 Nov;38(4):178-87
PMID: 11126776
Asami Y, Jia DW, Tatebayashi K, Yamagata K, Tanokura M, Ikeda H
Effect of the DNA topoisomerase II inhibitor VP-16 on illegitimate recombination in yeast chromosomes.
Gene 2002 May 29;291(1-2):251-7
PMID: 12095698
Matejckova A, Sychrova H
Biogenesis of a heterologous amino acid permease expressed in saccharomyces cerevisiae.
Folia Microbiol (Praha) 1997;42(3):243-4
PMID: 9378421
Coffman JA, Rai R, Cooper TG
Genetic evidence for Gln3p-independent, nitrogen catabolite repression-sensitive gene expression in Saccharomyces cerevisiae.
J Bacteriol 1995 Dec;177(23):6910-8
PMID: 7592485
Aguilera A
Formamide sensitivity: a novel conditional phenotype in yeast.
Genetics 1994 Jan;136(1):87-91
PMID: 8138179
Huang H, Hong JY, Burck CL, Liebman SW
Host genes that affect the target-site distribution of the yeast retrotransposon Ty1.
Genetics 1999 Apr;151(4):1393-407
PMID: 10101165
Hackett JA, Feldser DM, Greider CW
Telomere dysfunction increases mutation rate and genomic instability.
Cell 2001 Aug 10;106(3):275-86
PMID: 11509177
Pearce DA, Sherman F
Toxicity of copper, cobalt, and nickel salts is dependent on histidine metabolism in the yeast Saccharomyces cerevisiae.
J Bacteriol 1999 Aug;181(16):4774-9
PMID: 10438744
Farcasanu IC, Mizunuma M, Hirata D, Miyakawa T
Involvement of histidine permease (Hip1p) in manganese transport in Saccharomyces cerevisiae.
Mol Gen Genet 1998 Sep;259(5):541-8
PMID: 9790586
Kuehn MJ, Schekman R, Ljungdahl PO
Amino acid permeases require COPII components and the ER resident membrane protein Shr3p for packaging into transport vesicles in vitro.
J Cell Biol 1996 Nov;135(3):585-95
PMID: 8909535
McCann RO, Craig SW
Functional genomic analysis reveals the utility of the I/LWEQ module as a predictor of protein:actin interaction.
Biochem Biophys Res Commun 1999 Dec 9;266(1):135-40
PMID: 10581178
Wanker EE, Rovira C, Scherzinger E, Hasenbank R, Walter S, Tait D, Colicelli J, Lehrach H
HIP-I: a huntingtin interacting protein isolated by the yeast two-hybrid system.
Hum Mol Genet 1997 Mar;6(3):487-95
PMID: 9147654
Wright MB, Ramos J, Gomez MJ, Moulder K, Scherrer M, Munson G, Gaber RF
Potassium transport by amino acid permeases in Saccharomyces cerevisiae.
J Biol Chem 1997 May 23;272(21):13647-52
PMID: 9153214
Kalchman MA, Koide HB, McCutcheon K, Graham RK, Nichol K, Nishiyama K, Kazemi-Esfarjani P, Lynn FC, Wellington C, Metzler M, Goldberg YP, Kanazawa I, Gietz RD, Hayden MR
HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain.
Nat Genet 1997 May;16(1):44-53
PMID: 9140394
Bajmoczi M, Sneve M, Eide DJ, Drewes LR
TAT1 encodes a low-affinity histidine transporter in Saccharomyces cerevisiae.
Biochem Biophys Res Commun 1998 Feb 4;243(1):205-9
PMID: 9473505
Vandenbol M, Jauniaux JC, Grenson M
Nucleotide sequence of the Saccharomyces cerevisiae PUT4 proline-permease-encoding gene: similarities between CAN1, HIP1 and PUT4 permeases.
Gene 1989 Nov 15;83(1):153-9
PMID: 2687114
Engqvist-Goldstein AE, Kessels MM, Chopra VS, Hayden MR, Drubin DG
An actin-binding protein of the Sla2/Huntingtin interacting protein 1 family is a novel component of clathrin-coated pits and vesicles.
J Cell Biol 1999 Dec 27;147(7):1503-18
PMID: 10613908
Pi J, Wookey PJ, Pittard AJ
Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.
J Bacteriol 1991 Jun;173(12):3622-9
PMID: 1711024
Segel GB, Boal TR, Cardillo TS, Murant FG, Lichtman MA, Sherman F
Isolation of a gene encoding a chaperonin-like protein by complementation of yeast amino acid transport mutants with human cDNA.
Proc Natl Acad Sci U S A 1992 Jul 1;89(13):6060-4
PMID: 1352881
Weber E, Chevallier MR, Jund R
Evolutionary relationship and secondary structure predictions in four transport proteins of Saccharomyces cerevisiae.
J Mol Evol 1988;27(4):341-50
PMID: 3146645
Xie Y, Varshavsky A
The N-end rule pathway is required for import of histidine in yeast lacking the kinesin-like protein Cin8p.
Curr Genet 1999 Sep;36(3):113-23
PMID: 10501933
Gilstring CF, Melin-Larsson M, Moliner AL, Ljungdahl PO
SHR3 function is linked to cOPII mediated ER vesicle formation.
Folia Microbiol (Praha) 1996;41(1):93
PMID: 9090835
Arroyo J, Garcia-Gonzalez M, Garcia-Saez MI, Sanchez M, Nombela C
The complete sequence of a 9037 bp DNA fragment of the right arm of Saccharomyces cerevisiae chromosome VII.
Yeast 1995 May;11(6):587-91
PMID: 7645350
Chopra VS, Metzler M, Rasper DM, Engqvist-Goldstein AE, Singaraja R, Gan L, Fichter KM, McCutcheon K, Drubin D, Nicholson DW, Hayden MR
HIP12 is a non-proapoptotic member of a gene family including HIP1, an interacting protein with huntingtin.
Mamm Genome 2000 Nov;11(11):1006-15
PMID: 11063258
Tanaka J, Fink GR
The histidine permease gene (HIP1) of Saccharomyces cerevisiae.
Gene 1985;38(1-3):205-14
PMID: 3905514
Hein C, Springael JY, Volland C, Haguenauer-Tsapis R, Andre B
NPl1, an essential yeast gene involved in induced degradation of Gap1 and Fur4 permeases, encodes the Rsp5 ubiquitin-protein ligase.
Mol Microbiol 1995 Oct;18(1):77-87
PMID: 8596462
Malkus P, Jiang F, Schekman R
Concentrative sorting of secretory cargo proteins into COPII-coated vesicles.
J Cell Biol 2002 Dec 23;159(6):915-21
PMID: 12499351
Chen EJ, Kaiser CA
Amino acids regulate the intracellular trafficking of the general amino acid permease of Saccharomycescerevisiae.
Proc Natl Acad Sci U S A 2002 Nov 12;99(23):14837-42
PMID: 12417748
Gilstring CF, Ljungdahl PO
A method for determining the in vivo topology of yeast polytopic membrane proteins demonstrates that Gap1p fully integrates into the membrane independently of Shr3p.
J Biol Chem 2000 Oct 6;275(40):31488-95
PMID: 10903320
Muniz M, Nuoffer C, Hauri HP, Riezman H
The Emp24 complex recruits a specific cargo molecule into endoplasmic reticulum-derived vesicles.
J Cell Biol 2000 Mar 6;148(5):925-30
PMID: 10704443
Iraqui I, Vissers S, Andre B, Urrestarazu A
Transcriptional induction by aromatic amino acids in Saccharomyces cerevisiae.
Mol Cell Biol 1999 May;19(5):3360-71
PMID: 10207060
Springael JY, Galan JM, Haguenauer-Tsapis R, Andre B
NH4+-induced down-regulation of the Saccharomyces cerevisiae Gap1p permease involves its ubiquitination with lysine-63-linked chains.
J Cell Sci 1999 May;112 ( Pt 9):1375-83
PMID: 10194416
During-Olsen L, Regenberg B, Gjermansen C, Kielland-Brandt MC, Hansen J
Cysteine uptake by Saccharomyces cerevisiae is accomplished by multiple permeases.
Curr Genet 1999 Jul;35(6):609-17
PMID: 10467005
Stolz J, Sauer N
The fenpropimorph resistance gene FEN2 from Saccharomyces cerevisiae encodes a plasma membrane H+-pantothenate symporter.
J Biol Chem 1999 Jun 25;274(26):18747-52
PMID: 10373490
Roberg KJ, Rowley N, Kaiser CA
Physiological regulation of membrane protein sorting late in the secretory pathway of Saccharomyces cerevisiae.
J Cell Biol 1997 Jun 30;137(7):1469-82
PMID: 9199164
Helliwell SB, Losko S, Kaiser CA
Components of a ubiquitin ligase complex specify polyubiquitination and intracellular trafficking of the general amino acid permease.
J Cell Biol 2001 May 14;153(4):649-62
PMID: 11352928
Gilstring CF, Melin-Larsson M, Ljungdahl PO
Shr3p mediates specific COPII coatomer-cargo interactions required for the packaging of amino acid permeases into ER-derived transport vesicles.
Mol Biol Cell 1999 Nov;10(11):3549-65
PMID: 10564255
Magasanik B, Kaiser CA
Nitrogen regulation in Saccharomyces cerevisiae.
Gene 2002 May 15;290(1-2):1-18
PMID: 12062797
Omura F, Kodama Y, Ashikari T
The N-terminal domain of the yeast permease Bap2p plays a role in its degradation.
Biochem Biophys Res Commun 2001 Oct 12;287(5):1045-50
PMID: 11587526
Didion T, Grausland M, Kielland-Brandt C, Andersen HA
Amino acids induce expression of BAP2, a branched-chain amino acid permease gene in Saccharomyces cerevisiae.
J Bacteriol 1996 Apr;178(7):2025-9
PMID: 8606179

Options:

Limit of E-value: 1e-20
Limit of Length: 100000
Limit of references returned each search: 40
Limit of retry times: 3
Direct references: Yes
Indirect references: Yes
Allow symbol with hyphen: Yes
Use stop word list: Yes
Thesaurus:
- Saccharomyces cerevisiae (Version: 20021123.0)




 
BLASTN 2.2.5 [Nov-16-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
RID: 1048252710-014666-11725
Query= ORFN:YDR160W SSY1 SGDID:S0002567, Chr IV from 776156-778714
         (2559 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences) 
           1,707,549 sequences; 7,931,913,529 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|899393|emb|Z50046.1|SC8358 S.cerevisiae chromosome IV cosmid ...  3178   0.0  
gi|21206215|gb|AC008427.9| Homo sapiens chromosome 5 clone CTC-3...    48   0.068
gi|22945831|gb|AE003616.2| Drosophila melanogaster chromosome 2L...    44   1.1  
gi|15451502|gb|AC008326.9| Drosophila melanogaster, chromosome 2...    44   1.1  
gi|13129405|gb|AC012675.5|AC012675 Drosophila melanogaster, chro...    44   1.1  
gi|24060136|dbj|AP005516.3| Oryza sativa (japonica cultivar-grou...    44   1.1  
gi|29029231|gb|AC092289.3| Homo sapiens chromosome 16 clone CTD-...    42   4.2  
gi|21693905|gb|AC090714.9| Oryza sativa chromosome 3 BAC OSJNBb0...    42   4.2  
gi|28195582|gb|AC126796.4| Mus musculus chromosome 10 clone RP23...    42   4.2  
gi|22213300|gb|AC105029.7| Homo sapiens chromosome 8, clone CTD-...    42   4.2  
gi|23494865|gb|AE014829.1| Plasmodium falciparum 3D7 chromosome ...    42   4.2  
gi|20387449|gb|AC026877.15| Homo sapiens 3 BAC RP11-550F7 (Roswe...    42   4.2  
gi|20163175|gb|AC108475.5| Homo sapiens BAC clone RP11-1365D11 f...    42   4.2  
gi|11038604|gb|AC010748.5| Homo sapiens BAC clone CTD-2532L16 fr...    42   4.2  
gi|28874696|emb|AL805914.14| Mouse DNA sequence from clone RP23-...    42   4.2  
gi|27652752|emb|AL928992.7| Mouse DNA sequence from clone RP23-2...    42   4.2  
gi|10440733|gb|AC013455.5|AC013455 Homo sapiens BAC clone CTD-23...    42   4.2  
gi|11322850|emb|AL365214.16| Human DNA sequence from clone RP11-...    42   4.2  
gi|26100655|dbj|AK082422.1| Mus musculus 0 day neonate cerebellu...    42   4.2  
gi|1220275|emb|Z70043.1|SPAC22E12 S.pombe chromosome I cosmid c2...    42   4.2  
gi|565060|emb|X82435.1|SPKRP S.pombe krp1 gene                         42   4.2  
gi|21907928|dbj|AP004912.1| Lotus japonicus genomic DNA, chromos...    42   4.2  

ALIGNMENTS
>gi|899393|emb|Z50046.1|SC8358 S.cerevisiae chromosome IV cosmid 8358
          Length = 43468

 Score = 3178 bits (1603), Expect = 0.0
 Identities = 1633/1648 (99%)
 Strand = Plus / Plus

                                                                         
Query: 1     atgagttctgtcaaccaaatatatgacctatttcccaataagcataatatccaatttaca 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30650 atgagttctgtcaaccaaatatatgacctatttcccaataagcataatatccaatttaca 30709

                                                                         
Query: 61    gattctcattcacaggagcatgatacttcgtccagccttgctaagaatgatacagacgga 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30710 gattctcattcacaggagcatgatacttcgtccagccttgctaagaatgatacagacgga 30769

                                                                         
Query: 121   actataagtataccaggtagtatagacactggcattttaaagagcattattgaggagcaa 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30770 actataagtataccaggtagtatagacactggcattttaaagagcattattgaggagcaa 30829

                                                                         
Query: 181   ggttggaatgacgctgagttatatagaagttcaatacaaaatcaaagannnnnnnnaacg 240
             ||||||||||||||||||||||||||||||||||||||||||||||||        ||||
Sbjct: 30830 ggttggaatgacgctgagttatatagaagttcaatacaaaatcaaagattttttttaacg 30889

                                                                         
Query: 241   gataaatacactaaaaagaagcatttgactatggaggacatgcttagcccagaagaagaa 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30890 gataaatacactaaaaagaagcatttgactatggaggacatgcttagcccagaagaagaa 30949

                                                                         
Query: 301   caaatatatcaggaacctattcaagatttccaaacatataacaaacgtgttcaaagggaa 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30950 caaatatatcaggaacctattcaagatttccaaacatataacaaacgtgttcaaagggaa 31009

                                                                         
Query: 361   tatgagctcagggaaaggatggaagaattcttccgtcaaaacaccaaaaatgatttacat 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31010 tatgagctcagggaaaggatggaagaattcttccgtcaaaacaccaaaaatgatttacat 31069

                                                                         
Query: 421   attttaaacgaggattcattaaatcagcaatattccccgttaggacctgcagattatgtt 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31070 attttaaacgaggattcattaaatcagcaatattccccgttaggacctgcagattatgtt 31129

                                                                         
Query: 481   ctgcccctcgatagatactccagaatgaaacacattgcctcaaactttttcagnnnnnnn 540
             |||||||||||||||||||||||||||||||||||||||||||||||||||||       
Sbjct: 31130 ctgcccctcgatagatactccagaatgaaacacattgcctcaaactttttcagaaaaaaa 31189

                                                                         
Query: 541   cttggtattcctagaaaactgaaaagaagaagccattataatcccaacgcagagggccac 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31190 cttggtattcctagaaaactgaaaagaagaagccattataatcccaacgcagagggccac 31249

                                                                         
Query: 601   accaaagggaattcttctatattgagttccactactgatgtaattgataacgccagctac 660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31250 accaaagggaattcttctatattgagttccactactgatgtaattgataacgccagctac 31309

                                                                         
Query: 661   aggaatattgcaatagatgaaaatgttgacataacacataaagaacacgccattgacgaa 720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31310 aggaatattgcaatagatgaaaatgttgacataacacataaagaacacgccattgacgaa 31369

                                                                         
Query: 721   ataaacgagcagggtgcatcaggtagtgaatctgttgtggaaggtggatcgttattgcat 780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31370 ataaacgagcagggtgcatcaggtagtgaatctgttgtggaaggtggatcgttattgcat 31429

                                                                         
Query: 781   gacattgaaaaggttttcaataggtccagggcaactaggaaataccatatccaacggaaa 840
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31430 gacattgaaaaggttttcaataggtccagggcaactaggaaataccatatccaacggaaa 31489

                                                                         
Query: 841   ttaaaagtgcgccatattcaaatgctttctatcggggcttgctttagtgtcggattattt 900
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31490 ttaaaagtgcgccatattcaaatgctttctatcggggcttgctttagtgtcggattattt 31549

                                                                         
Query: 901   ttaacctcagggaaagccttttctattgccgggccatttggtacactacttgggtttgga 960
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31550 ttaacctcagggaaagccttttctattgccgggccatttggtacactacttgggtttgga 31609

                                                                         
Query: 961   ctcacaggtagcatcattttagccacaatgctgtcatttacagagttatccacccttatt 1020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31610 ctcacaggtagcatcattttagccacaatgctgtcatttacagagttatccacccttatt 31669

                                                                         
Query: 1021  cctgtgtcttctgggttctcaggactggcttctagatttgtagaggatgctttcggattt 1080
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31670 cctgtgtcttctgggttctcaggactggcttctagatttgtagaggatgctttcggattt 31729

                                                                         
Query: 1081  gcattgggctggacgtattggatttcctgtatgcttgctcttcctgcccaagtttcctca 1140
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31730 gcattgggctggacgtattggatttcctgtatgcttgctcttcctgcccaagtttcctca 31789

                                                                         
Query: 1141  agtacattctatctcagctattataataatgtcaatatatcaaagggagtaacagcaggg 1200
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31790 agtacattctatctcagctattataataatgtcaatatatcaaagggagtaacagcaggg 31849

                                                                         
Query: 1201  tttatcacgctgttttctgcatttagcattgtagtaaatttactggatgtcagcataatg 1260
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31850 tttatcacgctgttttctgcatttagcattgtagtaaatttactggatgtcagcataatg 31909

                                                                         
Query: 1261  ggtgaaattgtatatgttgctggaataagcaaagtgataattgcaattttgatggttttc 1320
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31910 ggtgaaattgtatatgttgctggaataagcaaagtgataattgcaattttgatggttttc 31969

                                                                         
Query: 1321  acgatgatcatcctaaatgccggacatggaaatgacattcacgaaggagtcggttttaga 1380
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31970 acgatgatcatcctaaatgccggacatggaaatgacattcacgaaggagtcggttttaga 32029

                                                                         
Query: 1381  tattgggatagctctaaatctgtccgaaatttgacctacgggctatatcgtccaacattt 1440
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32030 tattgggatagctctaaatctgtccgaaatttgacctacgggctatatcgtccaacattt 32089

                                                                         
Query: 1441  gacctggctgatgctggcgaaggaagcaaaaaaggaatttcaggcccaaaaggccgattt 1500
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32090 gacctggctgatgctggcgaaggaagcaaaaaaggaatttcaggcccaaaaggccgattt 32149

                                                                         
Query: 1501  ttagctacggcatcagtaatgctaatttcaacatttgcgtttagcggtgttgagatgact 1560
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32150 ttagctacggcatcagtaatgctaatttcaacatttgcgtttagcggtgttgagatgact 32209

                                                                         
Query: 1561  tttttagctagtggggaagctataaatccaaggaaaacaattccttctgctacaaaaagg 1620
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32210 tttttagctagtggggaagctataaatccaaggaaaacaattccttctgctacaaaaagg 32269

                                         
Query: 1621  acattttccattgtactgatatcttacg 1648
             ||||||||||||||||||||||||||||
Sbjct: 32270 acattttccattgtactgatatcttacg 32297



 Score = 1729 bits (872), Expect = 0.0
 Identities = 888/896 (99%)
 Strand = Plus / Plus

                                                                         
Query: 1664  cggtaggcatcaacatatacagtggcgatccaagactactatcatattttcctggtattt 1723
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32313 cggtaggcatcaacatatacagtggcgatccaagactactatcatattttcctggtattt 32372

                                                                         
Query: 1724  ccgaaaagaggtatgaagccattataaaaggcacaggaatggactggagacttaggacta 1783
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32373 ccgaaaagaggtatgaagccattataaaaggcacaggaatggactggagacttaggacta 32432

                                                                         
Query: 1784  attgtcgcggcggtattgattataggcagatttcagtaggaacaggttattctagtcctt 1843
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32433 attgtcgcggcggtattgattataggcagatttcagtaggaacaggttattctagtcctt 32492

                                                                         
Query: 1844  gggttgttgcattgcagaactttgggctatgtactttcgcatctgcttttaacgcaatac 1903
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32493 gggttgttgcattgcagaactttgggctatgtactttcgcatctgcttttaacgcaatac 32552

                                                                         
Query: 1904  tgatatttttcactgctacagcagggatatcctcgttatttagttgttcaagaacactat 1963
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32553 tgatatttttcactgctacagcagggatatcctcgttatttagttgttcaagaacactat 32612

                                                                         
Query: 1964  acgccatgtctgtacaacggaaggcaccgccagttttcgaaatttgcagcaagagaggtg 2023
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32613 acgccatgtctgtacaacggaaggcaccgccagttttcgaaatttgcagcaagagaggtg 32672

                                                                         
Query: 2024  ttccttatgtttcagtgatattctcctctttattttcagtcattgcttatattgcagttg 2083
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32673 ttccttatgtttcagtgatattctcctctttattttcagtcattgcttatattgcagttg 32732

                                                                         
Query: 2084  accaaaccgcgattgaaaacttcgacgtcttggccaatgtttctagtgctagtacgtcta 2143
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32733 accaaaccgcgattgaaaacttcgacgtcttggccaatgtttctagtgctagtacgtcta 32792

                                                                         
Query: 2144  ttatatggatgggattgaatctttcctttttgcgattctattacgccctaaaacaaagga 2203
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32793 ttatatggatgggattgaatctttcctttttgcgattctattacgccctaaaacaaagga 32852

                                                                         
Query: 2204  aggatattatatcaagaaatgattcatcatacccatataaatcgccattccaaccatatc 2263
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32853 aggatattatatcaagaaatgattcatcatacccatataaatcgccattccaaccatatc 32912

                                                                         
Query: 2264  tagcgatttatggtctagttggatgttcattatttgttatatttatgggatatcctaact 2323
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32913 tagcgatttatggtctagttggatgttcattatttgttatatttatgggatatcctaact 32972

                                                                         
Query: 2324  ttatacatcatttctggagtactaaagcnnnnnnnncagcatatggtggcctgatgtttt 2383
             ||||||||||||||||||||||||||||        ||||||||||||||||||||||||
Sbjct: 32973 ttatacatcatttctggagtactaaagcttttttttcagcatatggtggcctgatgtttt 33032

                                                                         
Query: 2384  tctttatcagttacacagcttataaggttctcggaacgtcaaagattcaaagactagatc 2443
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33033 tctttatcagttacacagcttataaggttctcggaacgtcaaagattcaaagactagatc 33092

                                                                         
Query: 2444  agttagatatggacagtgggaggagggaaatggacagaactgactggaccgaacatagcc 2503
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33093 agttagatatggacagtgggaggagggaaatggacagaactgactggaccgaacatagcc 33152

                                                                     
Query: 2504  aatatttgggaacatatagggaaagagcgaagaagttggttacctggctgatttag 2559
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 33153 aatatttgggaacatatagggaaagagcgaagaagttggttacctggctgatttag 33208


>gi|21206215|gb|AC008427.9| Homo sapiens chromosome 5 clone CTC-307M15, complete sequence
          Length = 175501

 Score = 48.1 bits (24), Expect = 0.068
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 286    agcccagaagaagaacaaatatat 309
              ||||||||||||||||||||||||
Sbjct: 109529 agcccagaagaagaacaaatatat 109552


>gi|22945831|gb|AE003616.2| Drosophila melanogaster chromosome 2L section 25 of 83 of the complete
             sequence
          Length = 267997

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1719  tatttccgaaaagaggtatgaa 1740
             ||||||||||||||||||||||
Sbjct: 68003 tatttccgaaaagaggtatgaa 67982


>gi|15451502|gb|AC008326.9| Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone
              BACR39J17, complete sequence
          Length = 148780

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 1719   tatttccgaaaagaggtatgaa 1740
              ||||||||||||||||||||||
Sbjct: 145498 tatttccgaaaagaggtatgaa 145477


>gi|13129405|gb|AC012675.5|AC012675 Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone
             BACR10E07, complete sequence
          Length = 176818

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1719  tatttccgaaaagaggtatgaa 1740
             ||||||||||||||||||||||
Sbjct: 14778 tatttccgaaaagaggtatgaa 14757


>gi|24060136|dbj|AP005516.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0066H10
          Length = 200968

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 318    tattcaagatttccaaacatataaca 343
              ||||| ||||||||||||||||||||
Sbjct: 171952 tattcgagatttccaaacatataaca 171927


>gi|29029231|gb|AC092289.3| Homo sapiens chromosome 16 clone CTD-2305H1, complete sequence
          Length = 129293

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 2453  tggacagtgggaggagggaaatggacaga 2481
             |||| |||||||||||||| |||||||||
Sbjct: 60024 tggagagtgggaggagggagatggacaga 59996


>gi|21693905|gb|AC090714.9| Oryza sativa chromosome 3 BAC OSJNBb0031G04 genomic sequence, complete
             sequence
          Length = 137297

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Plus

                                              
Query: 1460  aaggaagcaaaaaaggaatttcaggcccaaaag 1492
             ||||||| |||||||||||||| ||||||||||
Sbjct: 87460 aaggaagaaaaaaaggaatttc-ggcccaaaag 87491


>gi|28195582|gb|AC126796.4| Mus musculus chromosome 10 clone RP23-384F19, complete sequence
          Length = 211025

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1601   ttccttctgctacaaaaagga 1621
              |||||||||||||||||||||
Sbjct: 136580 ttccttctgctacaaaaagga 136600


>gi|22213300|gb|AC105029.7| Homo sapiens chromosome 8, clone CTD-2210A23, complete sequence
          Length = 123934

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1459  gaaggaagcaaaaaaggaatt 1479
             |||||||||||||||||||||
Sbjct: 53346 gaaggaagcaaaaaaggaatt 53366


>gi|23494865|gb|AE014829.1| Plasmodium falciparum 3D7 chromosome 10 section 1 of 7 of the complete
              sequence
          Length = 250078

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2292   attatttgttatatttatgggatat 2316
              |||||||||| ||||||||||||||
Sbjct: 144525 attatttgttttatttatgggatat 144501


>gi|20387449|gb|AC026877.15| Homo sapiens 3 BAC RP11-550F7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 198824

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1900   atactgatatttttcactgct 1920
              |||||||||||||||||||||
Sbjct: 114558 atactgatatttttcactgct 114538


>gi|20163175|gb|AC108475.5| Homo sapiens BAC clone RP11-1365D11 from 4, complete sequence
          Length = 51975

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   caaaaatgatttacatatttt 425
             |||||||||||||||||||||
Sbjct: 47668 caaaaatgatttacatatttt 47648


>gi|11038604|gb|AC010748.5| Homo sapiens BAC clone CTD-2532L16 from 16, complete sequence
          Length = 145459

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 2453   tggacagtgggaggagggaaatggacaga 2481
              |||| |||||||||||||| |||||||||
Sbjct: 126419 tggagagtgggaggagggagatggacaga 126391


>gi|28874696|emb|AL805914.14| Mouse DNA sequence from clone RP23-159N16 on chromosome 4, complete
             sequence
          Length = 48063

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1585  aatccaaggaaaacaattcct 1605
             |||||||||||||||||||||
Sbjct: 41376 aatccaaggaaaacaattcct 41356


>gi|27652752|emb|AL928992.7| Mouse DNA sequence from clone RP23-208O9 on chromosome 2, complete
             sequence
          Length = 136064

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 2214  atcaagaaatgattcatcata 2234
             |||||||||||||||||||||
Sbjct: 99900 atcaagaaatgattcatcata 99920


>gi|10440733|gb|AC013455.5|AC013455 Homo sapiens BAC clone CTD-2347O14 from 7p12-p14, complete sequence
          Length = 13773

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 407  aaaatgatttacatattttaa 427
            |||||||||||||||||||||
Sbjct: 6921 aaaatgatttacatattttaa 6941


>gi|11322850|emb|AL365214.16| Human DNA sequence from clone RP11-506B6 on chromosome 6, complete
              sequence
          Length = 210107

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1114   cttgctcttcctgcccaagtt 1134
              |||||||||||||||||||||
Sbjct: 104084 cttgctcttcctgcccaagtt 104104


>gi|26100655|dbj|AK082422.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230048O06
            product:unclassifiable, full insert sequence
          Length = 4047

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1585 aatccaaggaaaacaattcct 1605
            |||||||||||||||||||||
Sbjct: 3739 aatccaaggaaaacaattcct 3719


>gi|1220275|emb|Z70043.1|SPAC22E12 S.pombe chromosome I cosmid c22E12
          Length = 37172

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1295  tgataattgcaattttgatgg 1315
             |||||||||||||||||||||
Sbjct: 15429 tgataattgcaattttgatgg 15409


>gi|565060|emb|X82435.1|SPKRP S.pombe krp1 gene
          Length = 2500

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1295 tgataattgcaattttgatgg 1315
            |||||||||||||||||||||
Sbjct: 1115 tgataattgcaattttgatgg 1135


>gi|21907928|dbj|AP004912.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT11L19, TM0070,
              complete sequence
          Length = 128164

 Score = 42.1 bits (21), Expect = 4.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1298   taattgcaattttgatggttt 1318
              |||||||||||||||||||||
Sbjct: 107368 taattgcaattttgatggttt 107348


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
  or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Mar 20, 2003 10:39 PM
  Number of letters in database: -658,021,059
  Number of sequences in database:  1,707,549
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 12,139,850
Number of Sequences: 1707549
Number of extensions: 12139850
Number of successful extensions: 81199
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 81141
Number of HSP's gapped (non-prelim): 58
length of query: 2559
length of database: 7,931,913,529
effective HSP length: 22
effective length of query: 2537
effective length of database: 7,894,347,451
effective search space: 20027959483187
effective search space used: 20027959483187
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)






 
BLASTX 2.2.5 [Nov-16-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
RID: 1048254957-08664-26124
Query= ORFN:YDR160W SSY1 SGDID:S0002567, Chr IV from 776156-778714
         (2559 letters)

Database: All non-redundant GenBank CDS
translations+PDB+SwissProt+PIR+PRF 
           1,376,251 sequences; 442,128,549 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|6320364|ref|NP_010444.1| Ssy1p controls expression of several...  1590   0.0  
gi|15485608|emb|CAC67419.1| amino acid transporter [Uromyces fabae]   283   1e-74
gi|28921799|gb|EAA31076.1| hypothetical protein [Neurospora crassa]   269   2e-70
gi|6324990|ref|NP_015058.1| dicarboxylic amino acid permease; Di...   238   4e-61
gi|1764098|gb|AAB39866.1| putative permease [Uromyces fabae]          235   3e-60
gi|28565044|gb|AAO32605.1| DIP5 [Kluyveromyces lactis]                234   7e-60
gi|4468097|emb|CAB38005.1| amino acid transporter [Amanita musca...   225   3e-57
gi|28564978|gb|AAO32573.1| DIP5 [Saccharomyces kluyveri]              222   2e-56
gi|28923454|gb|EAA32636.1| hypothetical protein [Neurospora crassa]   222   3e-56
gi|28564047|gb|AAO32402.1| LYP1 [Saccharomyces bayanus]               220   1e-55
gi|28564447|gb|AAO32502.1| CAN1 [Saccharomyces castellii]             218   4e-55
gi|297445|emb|CAA47729.1| lysine permease [Saccharomyces cerevis...   217   8e-55
gi|6324061|ref|NP_014131.1| lysine permease; Lyp1p [Saccharomyce...   216   1e-54
gi|21217947|emb|CAD30326.1| aromatic amino acid and leucine perm...   214   5e-54
gi|19115921|ref|NP_595009.1| amino-acid permease [Schizosaccharo...   213   9e-54
gi|24210855|gb|AAN52080.1| general amino acid permease 1 [Hebelo...   212   3e-53
gi|28564045|gb|AAO32401.1| ALP1 [Saccharomyces bayanus]               210   8e-53
gi|6324059|ref|NP_014129.1| Homologous to permeases Can1p and Ly...   207   5e-52
gi|28564431|gb|AAO32499.1| CAN1 [Saccharomyces castellii]             205   3e-51
gi|496660|emb|CAA52199.1| basic amino acid permease [Saccharomyc...   204   4e-51
gi|6320772|ref|NP_010851.1| arginine permease; Can1p [Saccharomy...   203   1e-50
gi|6321629|ref|NP_011707.1| histidine permease; Hip1p [Saccharom...   203   1e-50
gi|3442|emb|CAA27416.1| put. CAN1 protein (aa 1-590)