MedBlast(0.8) Results

Direct References:

Hit Evalue SeqType References
X79151 0.0 N
Z35938 0.0 N
U10503 0.0 N  
X76294 0.0 N
AY144806 0.0 N
NP_009625 0.0 P  
P38085 0.0 P  
S45932 0.0 P  
CAA85013 0.0 P  
CAA55778 0.0 P  
AAA50552 0.0 P  
AAO32370 0.0 P  
AAO32556 0.0 P  
CAA53926 1e-179 P  
AAO32557 1e-154 P  
AAB48002 1e-152 P  
NP_010796 1e-152 P  
P48813 1e-152 P  
S69566 1e-152 P
AAB64950 1e-152 P  
AAO32369 1e-150 P  
P25376 1e-147 P  
S19352 1e-147 P  
AAO32478 1e-144 P  
NP_010331 1e-144 P  
P41815 1e-144 P  
S54032 1e-144 P
CAA89077 1e-144 P  
NP_009905 1e-143 P  
CAA42360 1e-143 P  
AAO32367 1e-143 P  
CAA52970 1e-142 P  
NP_009624 1e-141 P  
P38084 1e-141 P
S45930 1e-141 P  
CAA85012 1e-141 P  
AAO32479 1e-140 P  
BAB62308 1e-140 P  
BAB62309 1e-140 P  
2204190A 1e-139 P  
NP_012965 1e-119 P  
P19145 1e-119 P
S38111 1e-119 P
CAA82113 1e-119 P  
CAA36858 1e-117 P  
AAL76065 1e-110 P  
EAA30854 1e-107 P  
NP_011707 1e-106 P  
P06775 1e-106 P  
S55869 1e-106 P  
AAA34673 1e-106 P  
CAA57802 1e-106 P  
CAA97217 1e-106 P  
NP_014622 1e-103 P  
P38967 1e-103 P  
S46273 1e-103 P  
AAA60324 1e-103 P  
CAA55777 1e-103 P  
CAA99020 1e-103 P  
AAB07526 1e-103 P  
BAA03811 1e-102 P  
2105281A 1e-102 P  
T39122 1e-96 P  
NP_594316 2e-95 P  
CAB88273 2e-95 P  
CAB60021 3e-95 P  
1112180A 3e-93 P  
EAA35042 1e-92 P  
CAA99019 2e-91 P  
T47219 3e-91 P  
AAB61277 3e-91 P  
NP_015049 4e-91 P  
S65307 4e-91 P  
CAA98011 4e-91 P  
CAD21063 5e-91 P  
EAA26575 5e-91 P  
NP_596849 1e-88 P  
CAC21403 1e-88 P  
NP_013039 1e-87 P  
S50959 1e-87 P  
CAA87996 1e-87 P  
CAA97514 1e-87 P  
P34054 2e-86 P
S33212 2e-86 P  
CAA80308 2e-86 P  
NP_595053 4e-86 P  
Q9P5N2 4e-86 P  
CAB91572 4e-86 P  
NP_595000 3e-85 P  
P40901 3e-85 P  
T50059 3e-85 P  
CAB63545 3e-85 P  
S45492 3e-85 P  
BAA03148 3e-85 P  
AAO32368 9e-83 P  
AAN62330 8e-81 P  
CAB91570 1e-79 P  
NP_595008 3e-79 P  
CAB63555 3e-79 P  
NP_596769 2e-77 P  
CAB86887 2e-77 P  
NP_596348 2e-77 P  
O60170 2e-77 P  
T39829 2e-77 P  
CAA19126 2e-77 P  
Q92367 2e-77 P  
T43246 2e-77 P  
BAA13506 2e-77 P  
EAA32636 1e-71 P  
CAC67419 6e-71 P  
CAA98010 6e-70 P  

References Summary:

  1. Schmidt A, Hall MN, Koller A
    Two FK506 resistance-conferring genes in Saccharomyces cerevisiae, TAT1 and TAT2, encode amino acid permeases mediating tyrosine and tryptophan uptake.
    Mol Cell Biol 1994 Oct;14(10):6597-606
    PMID: 7523855
  2. Feldmann H, Aigle M, Aljinovic G, Andre B, Baclet MC, Barthe C, Baur A, Becam AM, Biteau N, Boles E, et al
    Complete DNA sequence of yeast chromosome II.
    EMBO J 1994 Dec 15;13(24):5795-809
    PMID: 7813418
  3. Van der Aart QJ, Barthe C, Doignon F, Aigle M, Crouzet M, Steensma HY
    Sequence analysis of a 31 kb DNA fragment from the right arm of Saccharomyces cerevisiae chromosome II.
    Yeast 1994 Jul;10(7):959-64
    PMID: 7985423
  4. Langkjaer RB, Cliften PF, Johnston M, Piskur J
    Yeast genome duplication was followed by asynchronous differentiation of duplicated genes.
    Nature 2003 Feb 20;421(6925):848-52
    PMID: 12594514
  5. Shilyansky J, Nishimura MI, Yannelli JR, Kawakami Y, Jacknin LS, Charmley P, Rosenberg SA
    T-cell receptor usage by melanoma-specific clonal and highly oligoclonal tumor-infiltrating lymphocyte lines.
    Proc Natl Acad Sci U S A 1994 Mar 29;91(7):2829-33
    PMID: 7511820
  6. Content J, de la Cuvellerie A, De Wit L, Vincent-Levy-Frebault V, Ooms J, De Bruyn J
    The genes coding for the antigen 85 complexes of Mycobacterium tuberculosis and Mycobacterium bovis BCG are members of a gene family: cloning, sequence determination, and genomic organization of the gene coding for antigen 85-C of M. tuberculosis.
    Infect Immun 1991 Sep;59(9):3205-12
    PMID: 1715324
  7. Nelissen B, Mordant P, Jonniaux JL, De Wachter R, Goffeau A
    Phylogenetic classification of the major superfamily of membrane transport facilitators, as deduced from yeast genome sequencing.
    FEBS Lett 1995 Dec 18;377(2):232-6
    PMID: 8543057
  8. Hahn M, Neef U, Struck C, Gottfert M, Mendgen K
    A putative amino acid transporter is specifically expressed in haustoria of the rust fungus Uromyces fabae.
    Mol Plant Microbe Interact 1997 May;10(4):438-45
    PMID: 9150593
  9. Yi TM, Walsh K, Schimmel P
    Rabbit muscle creatine kinase: genomic cloning, sequencing, and analysis of upstream sequences important for expression in myocytes.
    Nucleic Acids Res 1991 Jun 11;19(11):3027-33
    PMID: 2057360
  10. Li YQ, Ye LZ, Sugita M, Sugiura M
    Tobacco nuclear gene for the 31 kd chloroplast ribonucleoprotein: genomic organization, sequence analysis and expression.
    Nucleic Acids Res 1991 Jun 11;19(11):2987-91
    PMID: 2057356

 

Indirect References:

Hit Evalue SeqType References
X79151 0.0 N
Z35938 0.0 N
  • vap1p (-)
  • tat1p (...)
  • tat1 (...)
  • vap1 (...)
U10503 0.0 N
  • vap1p (-)
  • tat1p (...)
  • tat1 (...)
  • vap1 (...)
X76294 0.0 N  
AY144806 0.0 N  
NP_009625 0.0 P
  • vap1p (-)
  • tat1p (...)
  • vap1 (...)
  • tat1 (...)
P38085 0.0 P  
S45932 0.0 P  
CAA85013 0.0 P
  • vap1p (-)
  • tat1p (...)
  • tat1 (...)
  • vap1 (...)
CAA55778 0.0 P
  • vap1p (-)
  • tat1p (...)
  • vap1 (...)
  • tat1 (...)
AAA50552 0.0 P
  • vap1p (-)
  • tat1p (...)
  • tat1 (...)
  • vap1 (...)
AAO32370 0.0 P  
AAO32556 0.0 P  
CAA53926 1e-179 P  
AAO32557 1e-154 P  
AAB48002 1e-152 P
NP_010796 1e-152 P
  • gnp1 (...)
  • gnp1p (...)
P48813 1e-152 P  
S69566 1e-152 P  
AAB64950 1e-152 P
  • gnp1 (...)
  • gnp1p (...)
AAO32369 1e-150 P  
P25376 1e-147 P  
S19352 1e-147 P  
AAO32478 1e-144 P  
NP_010331 1e-144 P
P41815 1e-144 P  
S54032 1e-144 P  
CAA89077 1e-144 P
NP_009905 1e-143 P
CAA42360 1e-143 P
  • agp1p (...)
  • ycc5 (...)
  • ycc5p (-)
  • agp1 (...)
AAO32367 1e-143 P  
CAA52970 1e-142 P
  • pap1p (...)
  • pap1 (...)
NP_009624 1e-141 P
P38084 1e-141 P  
S45930 1e-141 P  
CAA85012 1e-141 P
  • bap2p (...)
  • bap2 (...)
AAO32479 1e-140 P  
BAB62308 1e-140 P
BAB62309 1e-140 P
2204190A 1e-139 P  
NP_012965 1e-119 P
P19145 1e-119 P  
S38111 1e-119 P  
CAA82113 1e-119 P
  • gap1 (...)
  • gap1p (...)
CAA36858 1e-117 P  
AAL76065 1e-110 P  
EAA30854 1e-107 P  
NP_011707 1e-106 P
P06775 1e-106 P  
S55869 1e-106 P  
AAA34673 1e-106 P  
CAA57802 1e-106 P
CAA97217 1e-106 P
  • hip1p (...)
  • hip1 (...)
NP_014622 1e-103 P
P38967 1e-103 P  
S46273 1e-103 P  
AAA60324 1e-103 P
  • sab2 (...)
  • tap2 (...)
  • scm2p (-)
  • ltg3p (-)
  • tat2p (...)
  • tat2 (...)
  • ltg3 (...)
  • sab2p (-)
  • tap2p (-)
  • scm2 (...)
CAA55777 1e-103 P
  • sab2 (...)
  • tap2 (...)
  • scm2p (-)
  • ltg3p (-)
  • tat2p (...)
  • tat2 (...)
  • ltg3 (...)
  • sab2p (-)
  • tap2p (-)
  • scm2 (...)
CAA99020 1e-103 P
  • sab2 (...)
  • tap2 (...)
  • scm2p (-)
  • ltg3p (-)
  • tat2p (...)
  • tat2 (...)
  • ltg3 (...)
  • sab2p (-)
  • tap2p (-)
  • scm2 (...)
AAB07526 1e-103 P
  • tap2 (...)
  • sab2 (...)
  • scm2p (-)
  • ltg3p (-)
  • tat2p (...)
  • tat2 (...)
  • ltg3 (...)
  • sab2p (-)
  • tap2p (-)
  • scm2 (...)
BAA03811 1e-102 P
  • sab2 (...)
  • tap2 (...)
  • scm2p (-)
  • ltg3p (-)
  • tat2p (...)
  • ltg3 (...)
  • tat2 (...)
  • sab2p (-)
  • tap2p (-)
  • scm2 (...)
2105281A 1e-102 P  
T39122 1e-96 P  
NP_594316 2e-95 P  
CAB88273 2e-95 P  
CAB60021 3e-95 P  
1112180A 3e-93 P  
EAA35042 1e-92 P  
CAA99019 2e-91 P
  • sab2 (...)
  • tap2 (...)
  • scm2p (-)
  • ltg3p (-)
  • tat2p (...)
  • tat2 (...)
  • ltg3 (...)
  • sab2p (-)
  • tap2p (-)
  • scm2 (...)
T47219 3e-91 P  
AAB61277 3e-91 P
  • naap1 (-)
NP_015049 4e-91 P
S65307 4e-91 P  
CAA98011 4e-91 P  
CAD21063 5e-91 P  
EAA26575 5e-91 P  
NP_596849 1e-88 P  
CAC21403 1e-88 P  
NP_013039 1e-87 P
S50959 1e-87 P  
CAA87996 1e-87 P  
CAA97514 1e-87 P  
P34054 2e-86 P  
S33212 2e-86 P  
CAA80308 2e-86 P
NP_595053 4e-86 P  
Q9P5N2 4e-86 P  
CAB91572 4e-86 P  
NP_595000 3e-85 P
P40901 3e-85 P  
T50059 3e-85 P  
CAB63545 3e-85 P  
S45492 3e-85 P  
BAA03148 3e-85 P  
AAO32368 9e-83 P  
AAN62330 8e-81 P  
CAB91570 1e-79 P  
NP_595008 3e-79 P  
CAB63555 3e-79 P  
NP_596769 2e-77 P  
CAB86887 2e-77 P  
NP_596348 2e-77 P  
O60170 2e-77 P  
T39829 2e-77 P  
CAA19126 2e-77 P  
Q92367 2e-77 P  
T43246 2e-77 P  
BAA13506 2e-77 P  
EAA32636 1e-71 P  
CAC67419 6e-71 P
  • aat1 (-)
CAA98010 6e-70 P  

References Summary:

  1. Grzanowski A, Needleman R, Brusilow WS
    Immunosuppressant-like effects of phenylbutyrate on growth inhibition of Saccharomyces cerevisiae.
    Curr Genet 2002 Jun;41(3):142-9
    PMID: 12111095
  2. During-Olsen L, Regenberg B, Gjermansen C, Kielland-Brandt MC, Hansen J
    Cysteine uptake by Saccharomyces cerevisiae is accomplished by multiple permeases.
    Curr Genet 1999 Jul;35(6):609-17
    PMID: 10467005
  3. Nielsen PS, van den Hazel B, Didion T, de Boer M, Jorgensen M, Planta RJ, Kielland-Brandt MC, Andersen HA
    Transcriptional regulation of the Saccharomyces cerevisiae amino acid permease gene BAP2.
    Mol Gen Genet 2001 Jan;264(5):613-22
    PMID: 11212916
  4. Giel-Pietraszuk M, Barciszewska MZ, Mucha P, Rekowski P, Kupryszewski G, Barciszewski J
    Interaction of HIV Tat model peptides with tRNA and 5S rRNA.
    Acta Biochim Pol 1997;44(3):591-600
    PMID: 9511968
  5. Marin I, Llorens C
    Ty3/Gypsy retrotransposons: description of new Arabidopsis thaliana elements and evolutionary perspectives derived from comparative genomic data.
    Mol Biol Evol 2000 Jul;17(7):1040-9
    PMID: 10889217
  6. Kopecka M, Gabriel M, Takeo K, Yamaguchi M, Svoboda A, Ohkusu M, Hata K, Yoshida S
    Microtubules and actin cytoskeleton in Cryptococcus neoformans compared with ascomycetous budding and fission yeasts.
    Eur J Cell Biol 2001 Apr;80(4):303-11
    PMID: 11370745
  7. Didion T, Regenberg B, Jorgensen MU, Kielland-Brandt MC, Andersen HA
    The permease homologue Ssy1p controls the expression of amino acid and peptide transporter genes in Saccharomyces cerevisiae.
    Mol Microbiol 1998 Feb;27(3):643-50
    PMID: 9489675
  8. Bajmoczi M, Sneve M, Eide DJ, Drewes LR
    TAT1 encodes a low-affinity histidine transporter in Saccharomyces cerevisiae.
    Biochem Biophys Res Commun 1998 Feb 4;243(1):205-9
    PMID: 9473505
  9. Forsberg H, Gilstring CF, Zargari A, Martinez P, Ljungdahl PO
    The role of the yeast plasma membrane SPS nutrient sensor in the metabolic response to extracellular amino acids.
    Mol Microbiol 2001 Oct;42(1):215-28
    PMID: 11679080
  10. Palmer LK, Wolfe D, Keeley JL, Keil RL
    Volatile anesthetics affect nutrient availability in yeast.
    Genetics 2002 Jun;161(2):563-74
    PMID: 12072454
  11. Nakamura H, Miura K, Fukuda Y, Shibuya I, Ohta A, Takagi M
    Phosphatidylserine synthesis required for the maximal tryptophan transport activity in Saccharomyces cerevisiae.
    Biosci Biotechnol Biochem 2000 Jan;64(1):167-72
    PMID: 10705462
  12. De Boer M, Bebelman JP, Goncalves PM, Maat J, Van Heerikhuizen H, Planta RJ
    Regulation of expression of the amino acid transporter gene BAP3 in Saccharomyces cerevisiae.
    Mol Microbiol 1998 Nov;30(3):603-13
    PMID: 9822825
  13. Schreve JL, Sin JK, Garrett JM
    The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine.
    J Bacteriol 1998 May;180(9):2556-9
    PMID: 9573211
  14. Kodama Y, Omura F, Takahashi K, Shirahige K, Ashikari T
    Genome-wide expression analysis of genes affected by amino acid sensor Ssy1p in Saccharomyces cerevisiae.
    Curr Genet 2002 May;41(2):63-72
    PMID: 12073087
  15. Zhu X, Garrett J, Schreve J, Michaeli T
    GNP1, the high-affinity glutamine permease of S. cerevisiae.
    Curr Genet 1996 Jul 31;30(2):107-14
    PMID: 8660458
  16. Regenberg B, Kielland-Brandt MC
    Amino acid residues important for substrate specificity of the amino acid permeases Can1p and Gnp1p in Saccharomyces cerevisiae.
    Yeast 2001 Nov;18(15):1429-40
    PMID: 11746604
  17. Regenberg B, During-Olsen L, Kielland-Brandt MC, Holmberg S
    Substrate specificity and gene expression of the amino-acid permeases in Saccharomyces cerevisiae.
    Curr Genet 1999 Dec;36(6):317-28
    PMID: 10654085
  18. Helmling S, Zhelkovsky A, Moore CL
    Fip1 regulates the activity of Poly(A) polymerase through multiple interactions.
    Mol Cell Biol 2001 Mar;21(6):2026-37
    PMID: 11238938
  19. Mandart E, Parker R
    Effects of mutations in the Saccharomyces cerevisiae RNA14, RNA15, and PAP1 genes on polyadenylation in vivo.
    Mol Cell Biol 1995 Dec;15(12):6979-86
    PMID: 8524265
  20. Amrani N, Dufour ME, Bonneaud N, Lacroute F
    Mutations in STS1 suppress the defect in 3' mRNA processing caused by the rna15-2 mutation in Saccharomyces cerevisiae.
    Mol Gen Genet 1996 Oct 16;252(5):552-62
    PMID: 8914516
  21. de Boer M, Nielsen PS, Bebelman JP, Heerikhuizen H, Andersen HA, Planta RJ
    Stp1p, Stp2p and Abf1p are involved in regulation of expression of the amino acid transporter gene BAP3 of Saccharomyces cerevisiae.
    Nucleic Acids Res 2000 Feb 15;28(4):974-81
    PMID: 10648791
  22. Mai B, Lipp M
    Cloning and chromosomal organization of a gene encoding a putative amino-acid permease from Saccharomyces cerevisiae.
    Gene 1994 May 27;143(1):129-33
    PMID: 8200527
  23. Preker PJ, Ohnacker M, Minvielle-Sebastia L, Keller W
    A multisubunit 3' end processing factor from yeast containing poly(A) polymerase and homologues of the subunits of mammalian cleavage and polyadenylation specificity factor.
    EMBO J 1997 Aug 1;16(15):4727-37
    PMID: 9303317
  24. Ohnacker M, Barabino SM, Preker PJ, Keller W
    The WD-repeat protein pfs2p bridges two essential factors within the yeast pre-mRNA 3'-end-processing complex.
    EMBO J 2000 Jan 4;19(1):37-47
    PMID: 10619842
  25. Minvielle-Sebastia L, Preker PJ, Wiederkehr T, Strahm Y, Keller W
    The major yeast poly(A)-binding protein is associated with cleavage factor IA and functions in premessenger RNA 3'-end formation.
    Proc Natl Acad Sci U S A 1997 Jul 22;94(15):7897-902
    PMID: 9223284
  26. Chapon C, Cech TR, Zaug AJ
    Polyadenylation of telomerase RNA in budding yeast.
    RNA 1997 Nov;3(11):1337-51
    PMID: 9409624
  27. Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG
    Phosphite, an analog of phosphate, suppresses the coordinated expression of genes under phosphate starvation.
    Plant Physiol 2002 Jul;129(3):1232-40
    PMID: 12114577
  28. Dusterhoft A, Philippsen P
    DNA sequencing and analysis of a 24.7 kb segment encompassing centromere CEN11 of Saccharomyces cerevisiae reveals nine previously unknown open reading frames.
    Yeast 1992 Sep;8(9):749-59
    PMID: 1441752
  29. Zhao J, Kessler M, Helmling S, O'Connor JP, Moore C
    Pta1, a component of yeast CF II, is required for both cleavage and poly(A) addition of mRNA precursor.
    Mol Cell Biol 1999 Nov;19(11):7733-40
    PMID: 10523662
  30. Hammell CM, Gross S, Zenklusen D, Heath CV, Stutz F, Moore C, Cole CN
    Coupling of termination, 3' processing, and mRNA export.
    Mol Cell Biol 2002 Sep;22(18):6441-57
    PMID: 12192043
  31. Grandori R, Carey J
    Six new candidate members of the alpha/beta twisted open-sheet family detected by sequence similarity to flavodoxin.
    Protein Sci 1994 Dec;3(12):2185-93
    PMID: 7756978
  32. del Olmo M, Mizrahi N, Gross S, Moore CL
    The Uba2 and Ufd1 proteins of Saccharomyces cerevisiae interact with poly(A) polymerase and affect the polyadenylation activity of cell extracts.
    Mol Gen Genet 1997 Jun;255(2):209-18
    PMID: 9236779
  33. Ohnacker M, Minvielle-Sebastia L, Keller W
    The Schizosaccharomyces pombe pla1 gene encodes a poly(A) polymerase and can functionally replace its Saccharomyces cerevisiae homologue.
    Nucleic Acids Res 1996 Jul 1;24(13):2585-91
    PMID: 8692700
  34. Minvielle-Sebastia L, Preker PJ, Keller W
    RNA14 and RNA15 proteins as components of a yeast pre-mRNA 3'-end processing factor.
    Science 1994 Dec 9;266(5191):1702-5
    PMID: 7992054
  35. Wiederkehr T, Pretot RF, Minvielle-Sebastia L
    Synthetic lethal interactions with conditional poly(A) polymerase alleles identify LCP5, a gene involved in 18S rRNA maturation.
    RNA 1998 Nov;4(11):1357-72
    PMID: 9814757
  36. Turi TG, Webster P, Rose JK
    Brefeldin A sensitivity and resistance in Schizosaccharomyces pombe. Isolation of multiple genes conferring resistance.
    J Biol Chem 1994 Sep 30;269(39):24229-36
    PMID: 7929079
  37. Brodsky AS, Silver PA
    Pre-mRNA processing factors are required for nuclear export.
    RNA 2000 Dec;6(12):1737-49
    PMID: 11142374
  38. Lee J, Dawes IW, Roe JH
    Isolation, expression, and regulation of the pgr1(+) gene encoding glutathione reductase absolutely required for the growth of Schizosaccharomyces pombe.
    J Biol Chem 1997 Sep 12;272(37):23042-9
    PMID: 9287302
  39. Proweller A, Butler JS
    Ribosome concentration contributes to discrimination against poly(A)- mRNA during translation initiation in Saccharomyces cerevisiae.
    J Biol Chem 1997 Feb 28;272(9):6004-10
    PMID: 9038222
  40. Patel D, Butler JS
    Conditional defect in mRNA 3' end processing caused by a mutation in the gene for poly(A) polymerase.
    Mol Cell Biol 1992 Jul;12(7):3297-304
    PMID: 1620131
  41. Bard J, Zhelkovsky AM, Helmling S, Earnest TN, Moore CL, Bohm A
    Structure of yeast poly(A) polymerase alone and in complex with 3'-dATP.
    Science 2000 Aug 25;289(5483):1346-9
    PMID: 10958780
  42. Birse CE, Minvielle-Sebastia L, Lee BA, Keller W, Proudfoot NJ
    Coupling termination of transcription to messenger RNA maturation in yeast.
    Science 1998 Apr 10;280(5361):298-301
    PMID: 9535662
  43. Proweller A, Butler S
    Efficient translation of poly(A)-deficient mRNAs in Saccharomyces cerevisiae.
    Genes Dev 1994 Nov 1;8(21):2629-40
    PMID: 7958921
  44. Briggs MW, Butler JS
    RNA polymerase III defects suppress a conditional-lethal poly(A) polymerase mutation in Saccharomyces cerevisiae.
    Genetics 1996 Jul;143(3):1149-61
    PMID: 8807289
  45. Preker PJ, Lingner J, Minvielle-Sebastia L, Keller W
    The FIP1 gene encodes a component of a yeast pre-mRNA polyadenylation factor that directly interacts with poly(A) polymerase.
    Cell 1995 May 5;81(3):379-89
    PMID: 7736590
  46. Wu JS, Xia ZX, Cao Z, Ao SZ
    Cloning and Expression of a Novel PHO85 Associated Protein PAP1 Gene of Saccharomyces cerevisiae.
    Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 1998;30(1):14-20
    PMID: 12174291
  47. Shi XZ, Ao SZ
    Analysis of phosphorylation of YJL084c, a yeast protein.
    Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 2002 Jul;34(4):433-8
    PMID: 12098764
  48. Mao XC, Xia YL, Hu YF, Lu CD
    [Involvement of PHO80 and PHO85 Genes in Saccharomyces cerevisiae Ion Tolerance]
    Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 2003 Jan;35(1):86-91
    PMID: 12518234
  49. Burkard KT, Butler JS
    A nuclear 3'-5' exonuclease involved in mRNA degradation interacts with Poly(A) polymerase and the hnRNA protein Npl3p.
    Mol Cell Biol 2000 Jan;20(2):604-16
    PMID: 10611239
  50. Kuge S, Toda T, Iizuka N, Nomoto A
    Crm1 (XpoI) dependent nuclear export of the budding yeast transcription factor yAP-1 is sensitive to oxidative stress.
    Genes Cells 1998 Aug;3(8):521-32
    PMID: 9797454
  51. Mizrahi N, Moore C
    Posttranslational phosphorylation and ubiquitination of the Saccharomyces cerevisiae Poly(A) polymerase at the S/G(2) stage of the cell cycle.
    Mol Cell Biol 2000 Apr;20(8):2794-802
    PMID: 10733582
  52. Iraqui I, Vissers S, Bernard F, de Craene JO, Boles E, Urrestarazu A, Andre B
    Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-Box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease.
    Mol Cell Biol 1999 Feb;19(2):989-1001
    PMID: 9891035
  53. Bernard F, Andre B
    Ubiquitin and the SCF(Grr1) ubiquitin ligase complex are involved in the signalling pathway activated by external amino acids in Saccharomyces cerevisiae.
    FEBS Lett 2001 May 11;496(2-3):81-5
    PMID: 11356187
  54. Tadi D, Hasan RN, Bussereau F, Boy-Marcotte E, Jacquet M
    Selection of genes repressed by cAMP that are induced by nutritional limitation in Saccharomyces cerevisiae.
    Yeast 1999 Dec;15(16):1733-45
    PMID: 10590462
  55. Bernard F, Andre B
    Genetic analysis of the signalling pathway activated by external amino acids in Saccharomyces cerevisiae.
    Mol Microbiol 2001 Jul;41(2):489-502
    PMID: 11489133
  56. Hsiung YG, Chang HC, Pellequer JL, La Valle R, Lanker S, Wittenberg C
    F-box protein Grr1 interacts with phosphorylated targets via the cationic surface of its leucine-rich repeat.
    Mol Cell Biol 2001 Apr;21(7):2506-20
    PMID: 11259599
  57. Didion T, Grausland M, Kielland-Brandt C, Andersen HA
    Amino acids induce expression of BAP2, a branched-chain amino acid permease gene in Saccharomyces cerevisiae.
    J Bacteriol 1996 Apr;178(7):2025-9
    PMID: 8606179
  58. Omura F, Kodama Y, Ashikari T
    The basal turnover of yeast branched-chain amino acid permease Bap2p requires its C-terminal tail.
    FEMS Microbiol Lett 2001 Jan 15;194(2):207-14
    PMID: 11164310
  59. Kodama Y, Omura F, Ashikari T
    Isolation and characterization of a gene specific to lager brewing yeast that encodes a branched-chain amino acid permease.
    Appl Environ Microbiol 2001 Aug;67(8):3455-62
    PMID: 11472919
  60. Omura F, Kodama Y, Ashikari T
    The N-terminal domain of the yeast permease Bap2p plays a role in its degradation.
    Biochem Biophys Res Commun 2001 Oct 12;287(5):1045-50
    PMID: 11587526
  61. Wright MB, Ramos J, Gomez MJ, Moulder K, Scherrer M, Munson G, Gaber RF
    Potassium transport by amino acid permeases in Saccharomyces cerevisiae.
    J Biol Chem 1997 May 23;272(21):13647-52
    PMID: 9153214
  62. Jorgensen MU, Bruun MB, Didion T, Kielland-Brandt MC
    Mutations in five loci affecting GAP1-independent uptake of neutral amino acids in yeast.
    Yeast 1998 Jan 30;14(2):103-14
    PMID: 9483800
  63. Hegner J, Siebert-Bartholmei C, Kothe E
    Ligand recognition in multiallelic pheromone receptors from the basidiomycete Schizophyllum commune studied in yeast.
    Fungal Genet Biol 1999 Apr;26(3):190-7
    PMID: 10361033
  64. Didion T, Grauslund M, Kielland-Brandt MC, Andersen HA
    Import of branched-chain amino acids in Saccharomyces cerevisiae.
    Folia Microbiol (Praha) 1996;41(1):87
    PMID: 9090831
  65. Barnes D, Lai W, Breslav M, Naider F, Becker JM
    PTR3, a novel gene mediating amino acid-inducible regulation of peptide transport in Saccharomyces cerevisiae.
    Mol Microbiol 1998 Jul;29(1):297-310
    PMID: 9701822
  66. Schreve J, Garrett JM
    The branched-chain amino acid permease gene of Saccharomyces cerevisiae, BAP2, encodes the high-affinity leucine permease (S1).
    Yeast 1997 Apr;13(5):435-9
    PMID: 9153753
  67. Nigavekar SS, Cannon JF
    Characterization of genes that are synthetically lethal with ade3 or leu2 in Saccharomyces cerevisiae.
    Yeast 2002 Jan 30;19(2):115-22
    PMID: 11788966
  68. Jorgensen MU, Gjermansen C, Andersen HA, Kielland-Brandt MC
    STP1, a gene involved in pre-tRNA processing in yeast, is important for amino-acid uptake and transcription of the permease gene BAP2.
    Curr Genet 1997 Mar;31(3):241-7
    PMID: 9065387
  69. Grauslund M, Didion T, Kielland-Brandt MC, Andersen HA
    BAP2, a gene encoding a permease for branched-chain amino acids in Saccharomyces cerevisiae.
    Biochim Biophys Acta 1995 Nov 30;1269(3):275-80
    PMID: 7495881
  70. Sipiczk M, Romano P, Lipani G, Miklos I, Antunovics Z
    Analysis of yeasts derived from natural fermentation in a Tokaj winery.
    Antonie Van Leeuwenhoek 2001 Jan;79(1):97-105
    PMID: 11392490
  71. Moyano L, Zea L, Moreno J, Medina M
    Analytical study of aromatic series in sherry wines subjected to biological aging.
    J Agric Food Chem 2002 Dec 4;50(25):7356-61
    PMID: 12452658
  72. Komiyama T, Shirai T, Ohta T, Urakami H, Furuichi Y, Ohta Y, Tsukada Y
    Action properties of HYI killer toxin from Williopsis saturnus var. saturnus, and antibiotics, aculeacin A and papulacandin B.
    Biol Pharm Bull 1998 Oct;21(10):1013-9
    PMID: 9821802
  73. Gognies S, Simon G, Belarbi A
    Regulation of the expression of endopolygalacturonase gene PGU1 in Saccharomyces.
    Yeast 2001 Mar 30;18(5):423-32
    PMID: 11255250
  74. Montrocher R, Verner MC, Briolay J, Gautier C, Marmeisse R
    Phylogenetic analysis of the Saccharomyces cerevisiae group based on polymorphisms of rDNA spacer sequences.
    Int J Syst Bacteriol 1998 Jan;48 Pt 1:295-303
    PMID: 9542100
  75. Fernandez-Espinar MT, Lopez V, Ramon D, Bartra E, Querol A
    Study of the authenticity of commercial wine yeast strains by molecular techniques.
    Int J Food Microbiol 2001 Oct 22;70(1-2):1-10
    PMID: 11759747
  76. Naumov GI, Naumova ES, Gaillardin C, Turakainen H, Korhola M
    Identification of new chromosomes of Saccharomyces bayanus using gene probes from S. cerevisiae.
    Hereditas 1994;120(2):121-6
    PMID: 8083058
  77. Bon E, Neuveglise C, Casaregola S, Artiguenave F, Wincker P, Aigle M, Durrens P
    Genomic exploration of the hemiascomycetous yeasts: 5. Saccharomyces bayanus var. uvarum.
    FEBS Lett 2000 Dec 22;487(1):37-41
    PMID: 11152880
  78. Naumov GI, Naumova ES, Aigle M, Masneuf I, Belarbi A
    Genetic reidentification of the pectinolytic yeast strain SCPP as Saccharomyces bayanus var. uvarum.
    Appl Microbiol Biotechnol 2001 Jan;55(1):108-11
    PMID: 11234950
  79. Sebastiani F, Barberio C, Casalone E, Cavalieri D, Polsinelli M
    Crosses between Saccharomyces cerevisiae and Saccharomyces bayanus generate fertile hybrids.
    Res Microbiol 2002 Jan-Feb;153(1):53-8
    PMID: 11881899
  80. Naumov GI, Naumova ES, Antunovics Z, Sipiczki M
    Saccharomyces bayanus var. uvarum in Tokaj wine-making of Slovakia and Hungary.
    Appl Microbiol Biotechnol 2002 Sep;59(6):727-30
    PMID: 12226732
  81. Savard T, Beaulieu C, Boucher I, Champagne CP
    Antimicrobial action of hydrolyzed chitosan against spoilage yeasts and lactic acid bacteria of fermented vegetables.
    J Food Prot 2002 May;65(5):828-33
    PMID: 12030295
  82. Osborne JP, Mira de Orduna R, Pilone GJ, Liu SQ
    Acetaldehyde metabolism by wine lactic acid bacteria.
    FEMS Microbiol Lett 2000 Oct 1;191(1):51-5
    PMID: 11004399
  83. Josepa S, Guillamon JM, Cano J
    PCR differentiation of Saccharomyces cerevisiae from Saccharomyces bayanus/Saccharomyces pastorianus using specific primers.
    FEMS Microbiol Lett 2000 Dec 15;193(2):255-9
    PMID: 11111033
  84. Wyder MT, Meile L, Teuber M
    Description of Saccharomyces turicensis sp. nov., a new species from kefyr.
    Syst Appl Microbiol 1999 Sep;22(3):420-5
    PMID: 10553294
  85. Turakainen H, Aho S, Korhola M
    MEL gene polymorphism in the genus Saccharomyces.
    Appl Environ Microbiol 1993 Aug;59(8):2622-30
    PMID: 8396384
  86. Ryu SL, Murooka Y, Kaneko Y
    Reciprocal translocation at duplicated RPL2 loci might cause speciation of Saccharomyces bayanus and Saccharomyces cerevisiae.
    Curr Genet 1998 May;33(5):345-51
    PMID: 9618585
  87. Giudici P, Caggia C, Pulvirenti A, Zambonelli C, Rainieri S
    Electrophoretic profile of hybrids between cryotolerant and non-cryotolerant Saccharomyces strains.
    Lett Appl Microbiol 1998 Jul;27(1):31-4
    PMID: 9722994
  88. Rainieri S, Zambonelli C, Hallsworth JE, Pulvirenti A, Giudici P
    Saccharomyces uvarum, a distinct group within Saccharomyces sensu stricto.
    FEMS Microbiol Lett 1999 Aug 1;177(1):177-85
    PMID: 10436934
  89. Marwan AG, Nagel CW
    Quantitative determination of infinite inhibition concentrations of antimicrobial agents.
    Appl Environ Microbiol 1986 Mar;51(3):559-61
    PMID: 3083773
  90. Kurtzman CP, Robnett CJ
    Phylogenetic relationships among species of Saccharomyces, Schizosaccharomyces, Debaryomyces and Schwanniomyces determined from partial ribosomal RNA sequences.
    Yeast 1991 Jan;7(1):61-72
    PMID: 2021083
  91. Edskes HK, Wickner RB
    Conservation of a portion of the S. cerevisiae Ure2p prion domain that interacts with the full-length protein.
    Proc Natl Acad Sci U S A 2002 Dec 10;99 Suppl 4:16384-91
    PMID: 12177423
  92. Gilliland RB
    The raffinose fermentation of Saccharomyces pastorianus and Saccharomyces bayanus.
    Antonie Van Leeuwenhoek 1969;35(1):13-23
    PMID: 5305792
  93. Delfini C, Gaia P, Schellino R, Strano M, Pagliara A, Ambro S
    Fermentability of grape must after inhibition with dimethyl dicarbonate (DMDC).
    J Agric Food Chem 2002 Sep 25;50(20):5605-11
    PMID: 12236685
  94. Stanbrough M, Magasanik B
    Two transcription factors, Gln3p and Nil1p, use the same GATAAG sites to activate the expression of GAP1 of Saccharomyces cerevisiae.
    J Bacteriol 1996 Apr;178(8):2465-8
    PMID: 8636059
  95. Stella CA, Korch C, Ramos EH, Bauer A, Kolling R, Mattoon JR
    The Saccharomyces cerevisiae LEP1/SAC3 gene is associated with leucine transport.
    Mol Gen Genet 1999 Sep;262(2):332-41
    PMID: 10517330
  96. ter Schure EG, Sillje HH, Verkleij AJ, Boonstra J, Verrips CT
    The concentration of ammonia regulates nitrogen metabolism in Saccharomyces cerevisiae.
    J Bacteriol 1995 Nov;177(22):6672-5
    PMID: 7592450
  97. Bon EP, Carvajal E, Stanbrough M, Rowen D, Magasanik B
    Asparaginase II of Saccharomyces cerevisiae. GLN3/URE2 regulation of a periplasmic enzyme.
    Appl Biochem Biotechnol 1997 Spring;63-65:203-12
    PMID: 9170245
  98. Szafer E, Pick E, Rotman M, Zuck S, Huber I, Cassel D
    Role of coatomer and phospholipids in GTPase-activating protein-dependent hydrolysis of GTP by ADP-ribosylation factor-1.
    J Biol Chem 2000 Aug 4;275(31):23615-9
    PMID: 10811810
  99. Soussi-Boudekou S, Andre B
    A co-activator of nitrogen-regulated transcription in Saccharomyces cerevisiae.
    Mol Microbiol 1999 Feb;31(3):753-62
    PMID: 10048020
  100. Rowen DW, Esiobu N, Magasanik B
    Role of GATA factor Nil2p in nitrogen regulation of gene expression in Saccharomyces cerevisiae.
    J Bacteriol 1997 Jun;179(11):3761-6
    PMID: 9171427
  101. Trip H, Evers ME, Konings WN, Driessen AJ
    Cloning and characterization of an aromatic amino acid and leucine permease of Penicillium chrysogenum.
    Biochim Biophys Acta 2002 Sep 20;1565(1):73-80
    PMID: 12225854
  102. Tate JJ, Cox KH, Rai R, Cooper TG
    Mks1p is required for negative regulation of retrograde gene expression in Saccharomyces cerevisiae but does not affect nitrogen catabolite repression-sensitive gene expression.
    J Biol Chem 2002 Jun 7;277(23):20477-82
    PMID: 11923302
  103. Saenz DA, Chianelli MS, Stella CA, Mattoon JR, Ramos EH
    RAS2/PKA pathway activity is involved in the nitrogen regulation of L-leucine uptake in Saccharomyces cerevisiae.
    Int J Biochem Cell Biol 1997 Mar;29(3):505-12
    PMID: 9202429
  104. ter Schure EG, Sillje HH, Vermeulen EE, Kalhorn JW, Verkleij AJ, Boonstra J, Verrips CT
    Repression of nitrogen catabolic genes by ammonia and glutamine in nitrogen-limited continuous cultures of Saccharomyces cerevisiae.
    Microbiology 1998 May;144 ( Pt 5):1451-62
    PMID: 9611819
  105. Hein C, Andre B
    A C-terminal di-leucine motif and nearby sequences are required for NH4(+)-induced inactivation and degradation of the general amino acid permease, Gap1p, of Saccharomyces cerevisiae.
    Mol Microbiol 1997 May;24(3):607-16
    PMID: 9179853
  106. Abe F, Horikoshi K
    Tryptophan permease gene TAT2 confers high-pressure growth in Saccharomyces cerevisiae.
    Mol Cell Biol 2000 Nov;20(21):8093-102
    PMID: 11027279
  107. Beck T, Schmidt A, Hall MN
    Starvation induces vacuolar targeting and degradation of the tryptophan permease in yeast.
    J Cell Biol 1999 Sep 20;146(6):1227-38
    PMID: 10491387
  108. Bermudez Moretti M, Correa Garcia S, Ramos E, Batlle A
    delta-Aminolevulinic acid uptake is mediated by the gamma-aminobutyric acid-specific permease UGA4.
    Cell Mol Biol (Noisy-le-grand) 1996 Jun;42(4):519-23
    PMID: 8828907
  109. Bermudez Moretti M, Correa Garcia S, Batlle A
    UGA4 gene expression in Saccharomyces cerevisiae depends on cell growth conditions.
    Cell Mol Biol (Noisy-le-grand) 1998 Jun;44(4):585-90
    PMID: 9678893
  110. Hein C, Springael JY, Volland C, Haguenauer-Tsapis R, Andre B
    NPl1, an essential yeast gene involved in induced degradation of Gap1 and Fur4 permeases, encodes the Rsp5 ubiquitin-protein ligase.
    Mol Microbiol 1995 Oct;18(1):77-87
    PMID: 8596462
  111. Amitrano AA, Saenz DA, Ramos EH
    GAP1 activity is dependent on cAMP in Saccharomyces cerevisiae.
    FEMS Microbiol Lett 1997 Jun 15;151(2):131-3
    PMID: 9228744
  112. Margolis-Clark E, Hunt I, Espinosa S, Bowman BJ
    Identification of the gene at the pmg locus, encoding system II, the general amino acid transporter in Neurospora crassa.
    Fungal Genet Biol 2001 Jul;33(2):127-35
    PMID: 11456465
  113. Regenberg B, Hansen J
    GAP1, a novel selection and counter-selection marker for multiple gene disruptions in Saccharomyces cerevisiae.
    Yeast 2000 Sep 15;16(12):1111-9
    PMID: 10953083
  114. Correa Garcia S, Bermudez Moretti M, Ramos E, Batlle A
    Carbon and nitrogen sources regulate delta-aminolevulinic acid and gamma-aminobutyric acid transport in Saccharomyces cerevisiae.
    Int J Biochem Cell Biol 1997 Aug-Sep;29(8-9):1097-101
    PMID: 9416005
  115. ter Schure EG, Sillje HH, Raeven LJ, Boonstra J, Verkleij AJ, Verrips CT
    Nitrogen-regulated transcription and enzyme activities in continuous cultures of Saccharomyces cerevisiae.
    Microbiology 1995 May;141 ( Pt 5):1101-8
    PMID: 7773405
  116. Goossens A, de La Fuente N, Forment J, Serrano R, Portillo F
    Regulation of yeast H(+)-ATPase by protein kinases belonging to a family dedicated to activation of plasma membrane transporters.
    Mol Cell Biol 2000 Oct;20(20):7654-61
    PMID: 11003661
  117. Stanbrough M, Rowen DW, Magasanik B
    Role of the GATA factors Gln3p and Nil1p of Saccharomyces cerevisiae in the expression of nitrogen-regulated genes.
    Proc Natl Acad Sci U S A 1995 Oct 10;92(21):9450-4
    PMID: 7568152
  118. Moreira RF, Ferreira-Da-Silva F, Fernandes PA, Moradas-Ferreira P
    Flocculation of Saccharomyces cerevisiae is induced by transformation with the GAP1 gene from Kluyveromyces marxianus.
    Yeast 2000 Feb;16(3):231-40
    PMID: 10649452
  119. Klasson H, Fink GR, Ljungdahl PO
    Ssy1p and Ptr3p are plasma membrane components of a yeast system that senses extracellular amino acids.
    Mol Cell Biol 1999 Aug;19(8):5405-16
    PMID: 10409731
  120. Coffman JA, Rai R, Cooper TG
    Genetic evidence for Gln3p-independent, nitrogen catabolite repression-sensitive gene expression in Saccharomyces cerevisiae.
    J Bacteriol 1995 Dec;177(23):6910-8
    PMID: 7592485
  121. Coffman JA, Rai R, Loprete DM, Cunningham T, Svetlov V, Cooper TG
    Cross regulation of four GATA factors that control nitrogen catabolic gene expression in Saccharomyces cerevisiae.
    J Bacteriol 1997 Jun;179(11):3416-29
    PMID: 9171383
  122. Szafer E, Rotman M, Cassel D
    Regulation of GTP hydrolysis on ADP-ribosylation factor-1 at the Golgi membrane.
    J Biol Chem 2001 Dec 21;276(51):47834-9
    PMID: 11592960
  123. Springael JY, Andre B
    Nitrogen-regulated ubiquitination of the Gap1 permease of Saccharomyces cerevisiae.
    Mol Biol Cell 1998 Jun;9(6):1253-63
    PMID: 9614172
  124. Springael JY, De Craene JO, Andre B
    The yeast Npi1/Rsp5 ubiquitin ligase lacking its N-terminal C2 domain is competent for ubiquitination but not for subsequent endocytosis of the gap1 permease.
    Biochem Biophys Res Commun 1999 Apr 13;257(2):561-6
    PMID: 10198251
  125. Chianelli MS, Stella CA, Saenz DA, Ramos EH, Kotliar N, Mattoon JR
    Isolation of a trifluoroleucine-resistant mutant of Saccharomyces cerevisiae deficient in both high- and low-affinity L-leucine transport.
    Cell Mol Biol (Noisy-le-grand) 1996 Sep;42(6):847-57
    PMID: 8891352
  126. De Craene JO, Soetens O, Andre B
    The Npr1 kinase controls biosynthetic and endocytic sorting of the yeast Gap1 permease.
    J Biol Chem 2001 Nov 23;276(47):43939-48
    PMID: 11500493
  127. Soetens O, De Craene JO, Andre B
    Ubiquitin is required for sorting to the vacuole of the yeast general amino acid permease, Gap1.
    J Biol Chem 2001 Nov 23;276(47):43949-57
    PMID: 11500494
  128. Springael JY, Nikko E, Andre B, Marini AM
    Yeast Npi3/Bro1 is involved in ubiquitin-dependent control of permease trafficking.
    FEBS Lett 2002 Apr 24;517(1-3):103-9
    PMID: 12062418
  129. Malkus P, Jiang F, Schekman R
    Concentrative sorting of secretory cargo proteins into COPII-coated vesicles.
    J Cell Biol 2002 Dec 23;159(6):915-21
    PMID: 12499351
  130. Chen EJ, Kaiser CA
    Amino acids regulate the intracellular trafficking of the general amino acid permease of Saccharomycescerevisiae.
    Proc Natl Acad Sci U S A 2002 Nov 12;99(23):14837-42
    PMID: 12417748
  131. Gilstring CF, Ljungdahl PO
    A method for determining the in vivo topology of yeast polytopic membrane proteins demonstrates that Gap1p fully integrates into the membrane independently of Shr3p.
    J Biol Chem 2000 Oct 6;275(40):31488-95
    PMID: 10903320
  132. Roberg KJ, Bickel S, Rowley N, Kaiser CA
    Control of amino acid permease sorting in the late secretory pathway of Saccharomyces cerevisiae by SEC13, LST4, LST7 and LST8.
    Genetics 1997 Dec;147(4):1569-84
    PMID: 9409822
  133. Muniz M, Nuoffer C, Hauri HP, Riezman H
    The Emp24 complex recruits a specific cargo molecule into endoplasmic reticulum-derived vesicles.
    J Cell Biol 2000 Mar 6;148(5):925-30
    PMID: 10704443
  134. Robl I, Grassl R, Tanner W, Opekarova M
    Construction of phosphatidylethanolamine-less strain of Saccharomyces cerevisiae. Effect on amino acid transport.
    Yeast 2001 Feb;18(3):251-60
    PMID: 11180458
  135. Iraqui I, Vissers S, Andre B, Urrestarazu A
    Transcriptional induction by aromatic amino acids in Saccharomyces cerevisiae.
    Mol Cell Biol 1999 May;19(5):3360-71
    PMID: 10207060
  136. Springael JY, Galan JM, Haguenauer-Tsapis R, Andre B
    NH4+-induced down-regulation of the Saccharomyces cerevisiae Gap1p permease involves its ubiquitination with lysine-63-linked chains.
    J Cell Sci 1999 May;112 ( Pt 9):1375-83
    PMID: 10194416
  137. Zikanova B, Kuthan M, Ricicova M, Forstova J, Palkova Z
    Amino acids control ammonia pulses in yeast colonies.
    Biochem Biophys Res Commun 2002 Jun 28;294(5):962-7
    PMID: 12074570
  138. Stolz J, Sauer N
    The fenpropimorph resistance gene FEN2 from Saccharomyces cerevisiae encodes a plasma membrane H+-pantothenate symporter.
    J Biol Chem 1999 Jun 25;274(26):18747-52
    PMID: 10373490
  139. Roberg KJ, Rowley N, Kaiser CA
    Physiological regulation of membrane protein sorting late in the secretory pathway of Saccharomyces cerevisiae.
    J Cell Biol 1997 Jun 30;137(7):1469-82
    PMID: 9199164
  140. Helliwell SB, Losko S, Kaiser CA
    Components of a ubiquitin ligase complex specify polyubiquitination and intracellular trafficking of the general amino acid permease.
    J Cell Biol 2001 May 14;153(4):649-62
    PMID: 11352928
  141. Gilstring CF, Melin-Larsson M, Ljungdahl PO
    Shr3p mediates specific COPII coatomer-cargo interactions required for the packaging of amino acid permeases into ER-derived transport vesicles.
    Mol Biol Cell 1999 Nov;10(11):3549-65
    PMID: 10564255
  142. Kuehn MJ, Schekman R, Ljungdahl PO
    Amino acid permeases require COPII components and the ER resident membrane protein Shr3p for packaging into transport vesicles in vitro.
    J Cell Biol 1996 Nov;135(3):585-95
    PMID: 8909535
  143. Magasanik B, Kaiser CA
    Nitrogen regulation in Saccharomyces cerevisiae.
    Gene 2002 May 15;290(1-2):1-18
    PMID: 12062797
  144. Pearce DA, Sherman F
    Toxicity of copper, cobalt, and nickel salts is dependent on histidine metabolism in the yeast Saccharomyces cerevisiae.
    J Bacteriol 1999 Aug;181(16):4774-9
    PMID: 10438744
  145. Farcasanu IC, Mizunuma M, Hirata D, Miyakawa T
    Involvement of histidine permease (Hip1p) in manganese transport in Saccharomyces cerevisiae.
    Mol Gen Genet 1998 Sep;259(5):541-8
    PMID: 9790586
  146. McCann RO, Craig SW
    Functional genomic analysis reveals the utility of the I/LWEQ module as a predictor of protein:actin interaction.
    Biochem Biophys Res Commun 1999 Dec 9;266(1):135-40
    PMID: 10581178
  147. Wanker EE, Rovira C, Scherzinger E, Hasenbank R, Walter S, Tait D, Colicelli J, Lehrach H
    HIP-I: a huntingtin interacting protein isolated by the yeast two-hybrid system.
    Hum Mol Genet 1997 Mar;6(3):487-95
    PMID: 9147654
  148. Kalchman MA, Koide HB, McCutcheon K, Graham RK, Nichol K, Nishiyama K, Kazemi-Esfarjani P, Lynn FC, Wellington C, Metzler M, Goldberg YP, Kanazawa I, Gietz RD, Hayden MR
    HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain.
    Nat Genet 1997 May;16(1):44-53
    PMID: 9140394
  149. Vandenbol M, Jauniaux JC, Grenson M
    Nucleotide sequence of the Saccharomyces cerevisiae PUT4 proline-permease-encoding gene: similarities between CAN1, HIP1 and PUT4 permeases.
    Gene 1989 Nov 15;83(1):153-9
    PMID: 2687114
  150. Engqvist-Goldstein AE, Kessels MM, Chopra VS, Hayden MR, Drubin DG
    An actin-binding protein of the Sla2/Huntingtin interacting protein 1 family is a novel component of clathrin-coated pits and vesicles.
    J Cell Biol 1999 Dec 27;147(7):1503-18
    PMID: 10613908
  151. Pi J, Wookey PJ, Pittard AJ
    Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.
    J Bacteriol 1991 Jun;173(12):3622-9
    PMID: 1711024
  152. Segel GB, Boal TR, Cardillo TS, Murant FG, Lichtman MA, Sherman F
    Isolation of a gene encoding a chaperonin-like protein by complementation of yeast amino acid transport mutants with human cDNA.
    Proc Natl Acad Sci U S A 1992 Jul 1;89(13):6060-4
    PMID: 1352881
  153. Weber E, Chevallier MR, Jund R
    Evolutionary relationship and secondary structure predictions in four transport proteins of Saccharomyces cerevisiae.
    J Mol Evol 1988;27(4):341-50
    PMID: 3146645
  154. Xie Y, Varshavsky A
    The N-end rule pathway is required for import of histidine in yeast lacking the kinesin-like protein Cin8p.
    Curr Genet 1999 Sep;36(3):113-23
    PMID: 10501933
  155. Gilstring CF, Melin-Larsson M, Moliner AL, Ljungdahl PO
    SHR3 function is linked to cOPII mediated ER vesicle formation.
    Folia Microbiol (Praha) 1996;41(1):93
    PMID: 9090835
  156. Arroyo J, Garcia-Gonzalez M, Garcia-Saez MI, Sanchez M, Nombela C
    The complete sequence of a 9037 bp DNA fragment of the right arm of Saccharomyces cerevisiae chromosome VII.
    Yeast 1995 May;11(6):587-91
    PMID: 7645350
  157. Chopra VS, Metzler M, Rasper DM, Engqvist-Goldstein AE, Singaraja R, Gan L, Fichter KM, McCutcheon K, Drubin D, Nicholson DW, Hayden MR
    HIP12 is a non-proapoptotic member of a gene family including HIP1, an interacting protein with huntingtin.
    Mamm Genome 2000 Nov;11(11):1006-15
    PMID: 11063258
  158. Tanaka J, Fink GR
    The histidine permease gene (HIP1) of Saccharomyces cerevisiae.
    Gene 1985;38(1-3):205-14
    PMID: 3905514
  159. Shin YH, Goo DM, So IS, Rhode PR, Campbell JL, Kim J
    Isolation and characterization of Saccharomyces cerevisiae SAB2, a suppressor gene for temperature-sensitive phenotype of ARS-binding factor 1 mutant.
    Biochem Mol Biol Int 1996 Nov;40(5):915-21
    PMID: 8955880
  160. Chen XH, Xiao Z, Fitzgerald-Hayes M
    SCM2, a tryptophan permease in Saccharomyces cerevisiae, is important for cell growth.
    Mol Gen Genet 1994 Aug 2;244(3):260-8
    PMID: 8058037
  161. Rad MR, Habbig B, Jansen G, Hattenhorst U, Kroll M, Hollenberg CP
    Analysis of the DNA sequence of a 34,038 bp region on the left arm of yeast chromosome XV.
    Yeast 1997 Mar 15;13(3):281-6
    PMID: 9090058
  162. Takami K, Zaleska-Rutczynska Z, Figueroa F, Klein J
    Linkage of LMP, TAP, and RING3 with Mhc class I rather than class II genes in the zebrafish.
    J Immunol 1997 Dec 15;159(12):6052-60
    PMID: 9550404
  163. Urlinger S, Kuchler K, Meyer TH, Uebel S, Tampe R
    Intracellular location, complex formation, and function of the transporter associated with antigen processing in yeast.
    Eur J Biochem 1997 Apr 15;245(2):266-72
    PMID: 9151952
  164. Schmidt A, Beck T, Koller A, Kunz J, Hall MN
    The TOR nutrient signalling pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease.
    EMBO J 1998 Dec 1;17(23):6924-31
    PMID: 9843498
  165. Skrzypek MS, Nagiec MM, Lester RL, Dickson RC
    Inhibition of amino acid transport by sphingoid long chain bases in Saccharomyces cerevisiae.
    J Biol Chem 1998 Jan 30;273(5):2829-34
    PMID: 9446592
  166. Rouillon A, Surdin-Kerjan Y, Thomas D
    Transport of sulfonium compounds. Characterization of the s-adenosylmethionine and s-methylmethionine permeases from the yeast Saccharomyces cerevisiae.
    J Biol Chem 1999 Oct 1;274(40):28096-105
    PMID: 10497160
  167. Rosenfeld SA, Ross OH, Hillman MC, Corman JI, Dowling RL
    Production and purification of human fibroblast collagenase (MMP-1) expressed in the methylotrophic yeast Pichia pastoris.
    Protein Expr Purif 1996 Jun;7(4):423-30
    PMID: 8776762
  168. Vasseur V, Van Montagu M, Goldman GH
    Trichoderma harzianum genes induced during growth on Rhizoctonia solani cell walls.
    Microbiology 1995 Apr;141 ( Pt 4):767-74
    PMID: 7773384
  169. Sato S, Suzuki H, Widyastuti U, Hotta Y, Tabata S
    Identification and characterization of genes induced during sexual differentiation in Schizosaccharomyces pombe.
    Curr Genet 1994 Jul;26(1):31-7
    PMID: 7954893
  170. Hunt C, Moore K, Xiang Z, Hurst SM, McDougall RC, Rajandream MA, Barrell BG, Gwilliam R, Wood V, Lyne MH, Aves SJ
    Subtelomeric sequence from the right arm of Schizosaccharomyces pombe chromosome I contains seven permease genes.
    Yeast 2001 Mar 15;18(4):355-61
    PMID: 11223945

 

Options:

 






 

BLASTN 2.2.5 [Nov-16-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
RID: 1048252378-09547-9285
Query= ORFN:YBR069C TAT1 SGDID:S0000273, Chr II from 376533-378392,
reverse complement
         (1860 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences) 
           1,707,549 sequences; 7,931,913,529 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|551281|emb|X79151.1|SCTAP1 S.cerevisiae TAT1 gene                 3604   0.0  
gi|4388568|emb|Z35938.1|SCYBR069C S.cerevisiae chromosome II rea...  3604   0.0  
gi|558076|gb|U10503.1|SCU10503 Saccharomyces cerevisiae JH 13-5C...  3588   0.0  
gi|974203|emb|X76294.1|SCTRAAA S.cerevisiae (S288C) HSP26, SEC18...  2076   0.0  
gi|28563982|gb|AY144806.1| Saccharomyces bayanus clone Contig390...   926   0.0  
gi|28564945|gb|AY144994.1| Saccharomyces kluyveri clone P2191 BA...    82   4e-12
gi|15054461|dbj|AB049009.1| Saccharomyces bayanus byBAP2-1 gene ...    70   1e-08
gi|15054459|dbj|AB049008.1| Saccharomyces pastorianus Lg-BAP2 ge...    70   1e-08
gi|28564943|gb|AY144993.1| Saccharomyces kluyveri clone Contig12...    68   5e-08
gi|28563978|gb|AY144804.1| Saccharomyces bayanus clone Contig258...    52   0.003
gi|798897|emb|Z49209.1|SC9609X S.cerevisiae chromosome IV cosmid...    52   0.003
gi|509204|emb|X75076.1|SCDNAPAP1 S.cerevisiae PAP1 gene                52   0.003
gi|14588895|emb|X59720.2|SCCHRIII S.cerevisiae chromosome III co...    48   0.049
gi|23172765|gb|AE003778.3| Drosophila melanogaster chromosome 3R...    42   3.0  
gi|28195581|gb|AC121775.3| Mus musculus chromosome 6 clone RP23-...    42   3.0  
gi|927764|gb|U33057.1|SCD9717 Saccharomyces cerevisiae chromosom...    42   3.0  
gi|19774314|gb|AC108696.2| Homo sapiens 3 BAC RP11-731C8 (Roswel...    42   3.0  
gi|15778815|gb|AC084383.1| Mus musculus clone RP23-10B20, comple...    42   3.0  
gi|17571266|ref|NG_000277.1| Drosophila melanogaster  (Gprk2) on...    42   3.0  
gi|18497273|gb|AC093909.2| Homo sapiens BAC clone RP11-756P10 fr...    42   3.0  
gi|18855130|gb|AC098581.2| Homo sapiens BAC clone RP11-1D6 from ...    42   3.0  
gi|14280259|gb|AC024595.5| Homo sapiens BAC clone RP11-84N19 fro...    42   3.0  
gi|26185587|emb|AL929221.6| Mouse DNA sequence from clone RP23-4...    42   3.0  
gi|13027523|gb|AC009349.6|AC009349 Drosophila melanogaster, chro...    42   3.0  
gi|12957610|gb|AC008287.4|AC008287 Drosophila melanogaster, chro...    42   3.0  
gi|17425245|dbj|AP002964.2| Homo sapiens genomic DNA, chromosome...    42   3.0  
gi|833811|gb|U21643.1|SCGNP1 Saccharomyces cerevisiae high-affin...    42   3.0  
gi|21425224|emb|AL513284.12| Human DNA sequence from clone RP11-...    42   3.0  

ALIGNMENTS
>gi|551281|emb|X79151.1|SCTAP1 S.cerevisiae TAT1 gene
          Length = 2186

 Score = 3604 bits (1818), Expect = 0.0
 Identities = 1846/1860 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggacgatagtgtcagtttcattgccaaagaggccagtccagcacaatattcgcacagt 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149  atggacgatagtgtcagtttcattgccaaagaggccagtccagcacaatattcgcacagt 208

                                                                        
Query: 61   ttgcatgaaagaacacacagtgaaaaacaaaagagagactttacaataacagaaaaacaa 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209  ttgcatgaaagaacacacagtgaaaaacaaaagagagactttacaataacagaaaaacaa 268

                                                                        
Query: 121  gatgaggtatctggacaaacagcggagcctcgaaggacggacagcaaatccatattacag 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 269  gatgaggtatctggacaaacagcggagcctcgaaggacggacagcaaatccatattacag 328

                                                                        
Query: 181  aggaaatgcaaagaattcttcgactcttttaaaaggcagctgccaccagaccgtaattcc 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329  aggaaatgcaaagaattcttcgactcttttaaaaggcagctgccaccagaccgtaattcc 388

                                                                        
Query: 241  gaactagagtcccaagnnnnnnncaacctgacaaagtcgatcaaatctcgtcacttagtc 300
            ||||||||||||||||       |||||||||||||||||||||||||||||||||||||
Sbjct: 389  gaactagagtcccaagaaaaaaacaacctgacaaagtcgatcaaatctcgtcacttagtc 448

                                                                        
Query: 301  atgatcagtctcggtaccggtataggtactggtttactggtcggtaatggtcaggtgctg 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449  atgatcagtctcggtaccggtataggtactggtttactggtcggtaatggtcaggtgctg 508

                                                                        
Query: 361  ggaacagctggtcctgccgggttagtccttggttacggaatagcatcgatcatgctttac 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509  ggaacagctggtcctgccgggttagtccttggttacggaatagcatcgatcatgctttac 568

                                                                        
Query: 421  tgtatcatccaagcggcaggcgagttaggtctctgttatgcaggactaaccggcaattac 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569  tgtatcatccaagcggcaggcgagttaggtctctgttatgcaggactaaccggcaattac 628

                                                                        
Query: 481  accagatatccttctattttagtcgacccttcgttgggttttgcagtttctgtggtttac 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 629  accagatatccttctattttagtcgacccttcgttgggttttgcagtttctgtggtttac 688

                                                                        
Query: 541  accattcaatggctaactgttctgcccttacaattggtcactgcggcaatgacagttaag 600
            ||||||||